Содержание

Правила crazyhouse (безумные шахматы)

Crazyhouse (иногда ошибочно называют bughouse) — шахматная игра для двоих игроков, близкая по своей сути к шведским шахматам (bughouse).

Пожалуй, главная причина, по которой она уступает в популярности шведкам, — сугубо технические

сложности, возникающие при игре в реале: хотя игра ведётся на стандартной шахматной доске

шахматными фигурами, одного стандартного комплекта шахматных фигур недостаточно.

Дело в том, что после каждого взятия сбитая фигура или пешка должна менять свой цвет на

противоположный, перекочёвывая в «рукав» игрока, который её уничтожил.

Наиболее простой и удобный вариант для игры в crazyhouse в реале — использование плоских фишек

(наподобие фишек для реверси) с изображениями шахматных фигур двух цветов (например, с

одной стороны фишки нарисован белый ферзь, с другой — чёрный). Уничтожив фигуру или пешку

соперника, игрок снимает фишку с её изображением с доски, переворачивает и кладёт перед собой на стол.

Цель игры — заматовать короля соперника.

Игра ведётся по обычным шахматным правилам, за одним важным исключением: при своей очереди хода

игрок может сделать ход по правилам шахмат или воспользоваться «рукавом», выставив любую

фигуру из имеющихся в его «рукаве» на любое без исключения свободное поле на доске, или любую пешку из «рукава» на любое свободное поле, кроме 1-й и 8-й горизонтали.

Пешка, достигшая 8-й горизонтали, может быть превращена в любую фигуру, кроме короля; однако,

будучи уничтоженной, такая фигура снова становится пешкой. Таковы международные правила Crazyhouse.

Однако crazyhouse на Гамблере имеет свои особенности:

  • 1) Запрещено выставление фигуры или пешки из «рукава» с матом.
  • 2) Запрещено выставление пешек не только на 1-ю и 8-ю, но и 7-ю горизонталь.
  • 3) После взятия превращённой фигуры она не становится пешкой.
  • хорошая фигура — Translation into English — examples Russian

    These examples may contain rude words based on your search.

    These examples may contain colloquial words based on your search.

    У меня хорошая фигура, я много позирую.

    You see, I have a rather nice figure, and I pose a lot.

    Простенькое лицо, но очень хорошая фигура

    У нее хорошая фигура, опыт…

    Если у тебя хорошая фигура, можно носить обтягивающую одежду.

    У нее хорошая фигура.

    Рыжеволосая девушка, нос с горбинкой и хорошая фигура.

    Но у неё должна быть хорошая фигура.

    У тебя такая же хорошая фигура, как и у нее.

    Я бы сказал, что у тебя хорошая фигура.

    Могу только сказать, что у неё хорошая фигура.

    У вас, на самом деле, очень хорошая фигура.

    Только так у тебя будет хорошая фигура.

    У тебя хорошая фигура, тюрьма тебе на пользу.

    Look at the shape you’re in. Jail serves you well.

    У меня и сейчас хорошая фигура, но она уже не та после родов.

    I still have a fine body but of course it’s never the same after childbirth.

    Я чуткий, широких взглядов, свободен от предрассудков и у меня хорошая фигура.

    I’m a tender, open-minded, free spirit, and I got a quality unit.

    Все говорят, что у меня хорошая фигура, я вам в профиль тоже покажу.

    Everyone says I have a great body, I’ll show you my side profile, too.

    Хорошая фигура важнее, чем образование, сын мой.

    У тебя очень хорошая фигура.

    У неё хорошая фигура.

    У Мэри хорошая фигура.

    Задержанный за убийство школьницы под Самарой полицейский оказался многодетным соседом

    + A —

    Тетя погибшей: «Она была куколкой»

    Родная тетя убитой сотрудником полиции 15-летней девушки из Самарской области рассказала правозащитникам подробности трагедии. Девятиклассница была знакома с подозреваемым в преступлении подполковником полиции, так как тот жил по соседству, но никаких романтических отношений, на что намекали некоторые СМИ, между ними не было. Версии случившегося множатся – и пока ни одна не похожа на правду.

    Тело зарезанной школьницы нашли поздним вечером в поселке Петра Дубрава (Волжский район Самарской области). По подозрению в убийстве задержали начальник отделения полиции по особо тяжким преступлениям, сотрудника угрозыска Самары. Свидетельница видела на месте преступления белую «Тойоту», по которой и вычислили подозреваемого.  

    Родственникам убитой сообщили о трагедии сотрудники полиции, которые приехали в квартиру ночью. Отец и тетя школьницы были сражены горем.

    До 2 часов ночи они давали показания в полиции. Подозреваемого в убийстве они знали: это сосед по дому. Подполковник с женой и тремя детьми жил на четвертом этаже, а школьница на пятом. Они здоровались при встрече, но не более того. Родные считают бредом сообщения о романе между девочкой и полицейским. Убитая не встречалась даже с парнями своего возраста.

    – Такая девочка была талантливая, – плачет тетя. – И рисовала красиво, а в последнее время спортом увлеклась, хотела, чтобы фигура была подтянутой.

    Она куколкой была, 1 метр 50 см ростом. И дома фитнесом занималась, и пробежки по полтора часа совершала. Иногда одна, иногда с подружками. Ничего не соображаю, очень тяжело. Ездили на кладбище, где ее дедушка с бабушкой похоронены, а в субботу пойдем покупать одежду для похорон

    В полиции сказали, что несчастная получила пять ножевых ранений.

    В этом трагическом происшествии остается много неясностей. Если верить изложенной в прессе версии подполковника (сегодня его уволили), то он сбил девочку на машине, испугался свидетелей и уехал. Но откуда в таком случае столько ножевых ранений? Как говорят источники в следствии, подполковник после убийства успел доехать до озера и утопить в нем прицеп автомобиля с окровавленной одеждой.

    Еще одна «ветка» версий – якобы потом полицейский стал рассказывать, что сбитая его машиной школьница «сама на него напала», от чего он потерял рассудок. Можете представить себе нападение хрупкой школьницы ростом метр пятьдесят сантиметров на сотрудника уголовного розыска.

       

    Версия о том, что полицейский хотел избавиться от сбитой им жертвы, тоже выглядит странно. Ведь девочку можно было спасти.

    Читайте материал «Убитую под Самарой школьницу воспитывал один отец — мать умерла» 

    Как одеваться c фигурой «яблоко» на примере Джессики Симпсон | French style

    Судя по статье про одежду для фигуры «перевернутый треугольник» на примере Волочковой (ссылка будет в конце статьи), читателям интереснее разбирать на живых примерах, как одеваться при разных типах фигуры.

    Сейчас предлагаю разобрать фигуру «яблоко» на примере Джессики Симпсон. Кстати, мне стоило некоторых усилий найти подходящий пример, так как те, кого относят к «яблоку» в основном располневшие «прямоугольники» и «перевернутые треугольники».

    На этом фото хорошо видно фигуру Джессики:

    Большая грудь, относительно длинные и спортивные ноги, не очень выраженная талия и выступающий живот.

    Снова оговорюсь, что рассматриваем мы именно подходящие силуэты, большая часть представленной одежды довольно специфическая для повседневной носки.

    Сначала предлагаю разобраться с вырезами. Глухой круглый вырез под горло делает торс мощным, а большая грудь в данном случае только утяжеляет силуэт:

    Я специально подобрала похожие комбинезоны, но с разными вырезами, чтобы было наглядней. Здесь V-образный вырез «разбивает» торс, за счет чего фигура кажется легче:

    Еще один удачный вариант выреза:

    Да, я уверена, что на всех трех фото на Джессике надето корректирующее белье, поэтому ниже груди не смотрим. И обтягиваться так тоже лучше не надо.

    Это хороший пример того, что просто «подчеркнуть талию пояском» не получится. Полностью обтягивающее платье + черная горизонтальная линия талию не формируют, получается крепко сбитая фигура без изгибов:

    Чтобы сделать талию, нужен объем в районе плеч и бедер, тогда на фоне большого количества ткани талия появится, например:

    V-образный вырез, четкие плечи и расклешенный низ хорошо формируют талию.

    Здесь не очень удачный верх, но на фоне баски талия тоже смотрится тоньше. А также, чуть завышенная линия талии скрывает животик:

    Платья А-силуэта, это спасение, если хочется скрыть живот. При отсутствии облегания не ясно, где закачивается ваше тело, поэтому прием хорошо работает в любых размерах. Особенно, если открыть стройные части тела, например ноги и руки в случае Джессики (или запястья, щиколотки и шею). Сравните с обтягивающим платьем:

    Обратите внимание, что даже небольшая свобода в районе живота и легкое расширение платья на запах делают женственные изгибы и маскируют живот. Сравните красное платье и обтягивающее черное (здесь Джессика в одном весе):

    Соответственно, если у вас фигура «яблоко», то присмотритесь к платьям А-силуэта и платьям на запах с немного завышенной талией. Ровно настолько завышенной, чтобы скрыть живот.

    Расстегнутый жакет облегчит торс за счет вертикальных линий и скроет не выраженную талию. Здесь Джессика в очень хорошей форме, но если живот сильно выступает, можно сделать напуск из рубашки, это скроет отсутствие стального пресса:

    Это не Джессика и не «яблоко», но виден эффект напуска (не ясно, где тело заканчивается):

    Пара антипримеров для наглядности

    справа: живот не надо обтягивать, только свободная посадка. А здесь еще и блестящая кожа:

    слева: большую грудь надо «собирать», юбки без минимального клеша делают и так неширокие бедра совсем не выраженными, и на их фоне торс кажется огромным. Если шея не очень длинная и тонкая, не надо подчеркивать это коротким колье:

    И еще один пример, как хорошо влияет на фигуру свободный расстегнутый верх и собранная грудь. Здесь Джессика беременная, а выглядит изящней, чем на многих фотографиях:

    Нюанс: брюки и юбки лучше выбирать со средней посадкой, низкая и высокая только подчеркнет живот и не очень узкую талию.

    Если Вам понравилась статья, ставьте лайк и подписывайтесь на канал, чтобы не пропускать новые выпуски о стиле большого города.

    Вам может быть интересно:

    Как стоит одеваться Насте Волочковой (силуэты для «перевернутого треугольника»

    Тяжелые бедра: как одеваться девушкам с фигурой «груша»

    Какие туфли подойдут для полных щиколоток

    Как Астафьев встретился за границей с самим собой

    Текст и фото: Игорь Карнаухов/РГ, Пермь

    Портреты ряда выдающихся советских писателей и деятелей искусства заняли почетное место на первой посмертной выставке творчества народного художника СССР Евгения Широкова, прошедшей в Центральном городском выставочном зале. Живописец ушел из жизни 31 декабря 2017 года. Многие известные люди страны доверяли себя искусному пермяку.

    Как прозаику попасть на обложку

    Одной из главных творческих удач западноуральского художника считается портрет Виктора Астафьева.

    Оригинал находится в Государственной Третьяковской галерее, поэтому в Перми был вывешен этюд. Этой картине почти полвека, однако ею по сей день можно иллюстрировать труд писателя. Астафьев изображен в рабочей обстановке в момент творческих терзаний. На столике, покрытом газетами, лежит раскрытая рукопись, пепельница перед героем полна окурков, вьется дымок папиросы. Лицо сосредоточено, взъерошены волосы не старого еще человека, крепкая, плотно сбитая фигура пронизана пульсирующей мыслью.

    — Как вспоминал Широков, в конце шестидесятых он пожаловал к прозаику домой (Виктор Петрович еще жил в Перми. — Прим. ред.), — рассказывает искусствовед Тамара Шматёнок. — Была зима. Астафьев сидел спиной к окну, сквозь изморозь на стекле падал характерный мягкий свет. Он работал, правил, кстати, многострадальных «Пастуха и пастушку». При этом нещадно курил, туша одну папиросу и тут же зажигая другую. Евгения Николаевича, как он поведал, поразила эта сцена, и художник изобразил персонажа в такой момент, не ища другой обстановки.

     

    Портрет снискал высокие оценки на выставке «Урал социалистический» в Челябинске, затем экспонировался на республиканской и всесоюзной выставках и был приобретен Третьяковкой.

    …Несколько лет спустя в составе советской делегации Астафьев поехал за границу. Товарищи шли по берлинской улице мимо то ли магазина, то ли киоска, и кто-то из спутников заметил на витрине немецкий журнал по тематике изобразительного искусства, на обложке которого… был этот портрет.

    «Выпили мы, Женя, и за тебя, и за меня как солдата. Надо же, сам с собой в Берлине встретился!» — восторженно писал Виктор Петрович художнику после этого.

    Чувство сильных

    В 1978 году в Прикамье проходили очередные Дни советской литературы. Двум видным их участникам, кого считал близкими себе по духу: выдающейся поэтессе Юлии Друниной и ее супругу, кинодраматургу и сценаристу Алексею Каплеру, — Широков предложил написать их. Гости откликнулись и посетили его мастерскую.

    В образе Друниной отражено ее фронтовое прошлое. Женщина изображена на фоне распахнутого окна, а кажется, перед зрителем распахнулась ее память: за горизонт убегают извилистые колеи, красные пятна в панораме вокруг напоминают вспышки разрывов. На первом плане, на фоне этого сгустившегося мрака поэтесса гордо вскинула голову, задумавшись о чем-то. От профиля веет неукротимым духом и упрямством.

    — Евгений Николаевич любил сильных людей, — отмечает Шматёнок. — И сам был сильным человеком.

    Зная дальнейшую трагическую судьбу Друниной: фронтовичка близко к сердцу принимала разрушительные процессы, ведшие к развалу Советского Союза, и, не смирившись с этим, покончила с собой, —


    поэт Юрий Беликов посчитал эту картину пророческой.


    А еще Широков запечатлел писательницу Викторию Токареву, пермских поэтов Владимира Радкевича и Игоря Тюленева, литературного критика Валентина Курбатова, актера Ефима Копеляна, по сей день более всего известного стране как голос за кадром в неувядающей экранизации «Семнадцати мгновений весны».

    Другие выдающиеся отечественные артисты запечатлены в образах литературных героев. Так, Иннокентий Смоктуновский изображен игравшим Гамлета, Евгений Лебедев — в роли толстовского Холстомера.

    Был представлен и ряд хрестоматийных изображений: А. С. Пушкина, Сергея Есенина, Михаила Шолохова, а также легендарных русских государственных деятелей и ученых, кого портретист не мог написать с натуры, а нарисовал их в начале девяностых для «Духовно-исторического центра молодежи».

    СПРАВКА

    Евгений Николаевич Широков (1931—2017) — крупный деятель отечественного реалистического искусства второй половины ХХ века. Почетный житель Перми и области, лауреат Строгановской премии (2011). Его работы хранятся в пятнадцати отечественных музеях и множестве частных собраний по стране и за рубежом.

    Кроме частных владельцев и семьи художника, экспонаты для первого вернисажа, развернувшегося после его ухода, предоставили Пермская государственная художественная галерея и Пермский институт культуры.

    Краткосрочная выставка, первая посвященная памяти его профессора, завершилась, однако большеформатные портреты и этюд к Астафьеву вернулись в постоянную экспозицию галереи, работы цикла «России славные сыны» — в институт, так что продолжать общение с наследием выдающегося земляка может каждый желающий житель Перми и гость города.

    Естественно, что в окружении таких картин у кого-то из причастных родилась мысль об открытии в городе Широковского зала — постоянного средоточия живописи мастера, где лики классиков литературы XX века займут подобающее место.

    восковые фигуры, скульптуры, знаменитости, художник

    Первой работой Арлиндо Армаколло стала восковая фигура Матери Терезы, затем появились Альберт Эйнштейн, Папа Иоанн Павел II и ряд мировых знаменитостей, которыми восхищался предприниматель, ставший художником.

    Мать Тереза

    «Это может показаться простым, но добиться такой детализации — нелегкое дело», — сказал местный тележурналист во время визита в 2015 году и осмотра коллекции восковых фигур Армаколло на юге Бразилии. «Художник хотел передать характер, а также душу каждого человека».

    Махатма Ганди

    Достиг ли 70-летний скульптор этой цели? Этот вопрос породил активную дискуссию, когда восковые творения стали вирусными в социальных сетях — через 6 лет после того, как их впервые выставили в городе Роландия.

    Принцесса Диана

    Кадры с поразительными работами Армаколло распространились как лесной пожар на прошлой неделе после того, как пользователи Интернета обнаружили и высмеяли видеоотчет об их выставке в местной церкви.

    Чарли Чаплин

    Среди жутко изуродованных фигур обнаружили Нельсона Манделу с телом странной формы, крошечной головой и высветленными перекисью водорода волосами; принцессу Диану с безумной устрашающей улыбкой; Мэрилин Монро, которая может похвастаться шеей размером со ствол дерева и будто бы расплавленным лицом, а также Элвиса Пресли, у которого из  блестящего воскового лица под необычными углами вырастают черные волосы.

    Нельсон Мандела

    «Бразильская история ужасов», — прокомментировала одна из пользователей Твиттера, сбитая с толку этими моделями. Слухи о коллекции вскоре распространились. Журналисты ведущих новостных агентств Бразилии и других стран обратили внимание на ранее неизвестного художника из-за такой бурной реакции и его новообретенной известности.

    Мэрилин Монро

    «Мне наплевать [на критику]», — заявил 77-летний Армаколло Guardian, когда его завалили просьбами об интервью и приглашениями на выступления на телевидении, которые он планировал отклонить. «Если бы речь шла о зарабатывании денег, меня могло бы беспокоить, ценят ли люди то, что я делаю, или нет. Но я делаю то, что делаю, потому что мне это нравится. Я сделал это для нашего города. Если людям нравится, приходите в гости. Если нет, не надо, — пожал он плечами. — Чего переживать?»

    Элвис Пресли

    Статуи Армаколло, каждая из которых состоит из примерно 5 кг воска и импортных английских глазных яблок, переместили с момента своего дебюта в 2015 году и теперь находятся в соседнем музее, названном в честь его отца. Там к принцессе Диане добавили более новые скульптуры, включая фигуру королевы.

    Елизавета II

    До недавнего времени в экспозиции выставлялась ​​статуя судьи Серхио Моро, борющегося с коррупцией. Но Армаколло убрал фигуру бывшего министра безопасности Бразилии после того, как он ушел из правительства и устроился на высокооплачиваемую работу в консалтинговой компании, участвовавшей в судебном оправдании одного из строительных гигантов, которым он когда-то занимался. «Это все немного странно, правда?» — сказал Армаколло.

    Как и многие на юге Бразилии, Армаколло — сторонник президента Жаира Болсонару и хотел создать его восковую фигуру. «Но потом я подумал: «Я собираюсь немного подождать, чтобы посмотреть на его поведение». Пока я все еще за него и думаю, что он на правильном пути, но давайте еще немного подождем, чтобы посмотреть, закрепит ли он результаты».

    Альберт Эйнштейн

    Художник высмеивал идею чествования левого соперника Болсонару, бывшего президента Луиса Инасиу Лула да Силва. «Вы не поддерживаете его, не так ли?» — спросил он репортера с недоверчивым смехом. Помимо политики, Армаколло надеялся, что «весь этот беспорядок» привлечет туристов из других городов и из-за границы. Подобный музей в Норфолке получил статус культового «худших в мире восковых работ», привлекая тысячи посетителей своими нереалистичными образами. Единственное, о чем сожалеет Армаколло, реакция его внучки-подростка, сильно расстроившейся из-за насмешек над манекенами своего деда. «Она очень чувствительная. Она даже плакала, — признался художник, — но теперь над этим смеется».

    Источник

    Комментарии

    Опубликованные материалы Международной конференции на портале «Солнечный Свет». Невроз отличника. Автор: Ерофеева Валерия Евгеньевна.

    Невроз отличника – пример работы психолога

    ​ — Это совершенно ужасно! То есть я хочу сказать, что это совершенно ужасно выглядит! — печально, но энергично сказала молодая, хорошо одетая женщина. Она сидела на стуле, прижимая к себе дорогую сумку из хорошей кожи и теребила-перебирала ее длинный ремень.

    Ее дочь со сказочным именем Василиса сидела в кресле напротив меня. У девочки было приятное, несколько простоватое лицо, крупные правильные черты, плотно сбитая фигура и крепкие ноги, туго обтянутые белыми колготками. На Василисе было также тяжелое широкое платье из темно-зеленого бархата с белым кружевным воротником и кружевными же манжетами. И воротник, и манжеты выглядели туго накрахмаленными. Больше всего на свете Василиса напоминала только что прошедшую превращение Царевну-лягушку, в которой еще сохранилось что-то отчетливо лягушачье.

    Мама Василисы рассказывала просто, без излишней экзальтации, но с идущими к делу эмоциями, именно так, как, в общем-то, и должен строить свой рассказ умственно и эмоционально полноценный человек. Слушать ее было приятно, хотя тема рассказа к тому вроде бы не располагала. Дочь слушала очень внимательно, никаких реплик и даже жестов себе не позволяла. Хотя речь шла именно о ней.

    — Перед школой я много занималась с Василисой. Я как раз тогда потеряла работу и времени у меня было достаточно. Вообще она очень способная девочка, читать и считать научилась очень рано, и идти в школу хотела еще в предыдущий год. Но я была против, так как ей тогда только-только шесть лет исполнилось. Зачем перегружать ребенка — так я тогда подумала. Василиса пошла в школу в семь лет, как все дети. Школу мы выбрали хорошую, тестирование Василиса прошла легко. Правда, меня тогда очень удивила ее реакция. Она так нервничала, как будто решалось невесть что. Я успокаивала ее, говорила, что все эти задания для нее просто тьфу (так оно на самом деле и оказалось), что, в конце концов, на этой именно школе свет клином не сошелся, и в городе еще полтысячи школ, многие из которых еще лучше этой, но она как бы меня не слышала. Я говорю об этом потому, что, может быть, это важно для понимания того, что происходит сегодня.

    Я энергично кивнула, потому что это действительно было важно.

    — Так вот, она меня как будто не слышала и слышала только то, что происходит где-то там, внутри нее. Но потом все как-то обошлось, то есть не обошлось даже, а кончилось очень хорошо, Василису все очень хвалили и зачислили в самый лучший «а» класс.

    Она с самого начала училась очень хорошо, но мы так и ожидали. В самом деле — девочка способная, подготовленная, аккуратная — почему нет? Учительница часто ставила Василису в пример другим детям, но вы не подумайте, что моя дочь от этого зазналась или еще что-нибудь такое. Василиса очень ответственная девочка, она понимала, что если ее ставят в пример, то нужно учиться еще лучше. И она всегда готова помочь другим, если нужно. Кроме учебы, в ее классе протекает весьма активная, как это раньше называли, общественная жизнь. Они ставят спектакли, готовятся к разным праздникам, выпускают стенгазету. Василиса принимала во всем этом активное участие, иногда дома что-то рисовала, учила, иногда задерживалась в школе. Я была не против, потому что мне казалось, что это полезно для общего развития. Может быть, это была перегрузка? Но ведь многие дети учатся в школе и одновременно посещают несколько кружков, и ничего с ними не происходит. А Василиса никаких кружков не посещала. Не знаю.

    Первый класс Василиса закончила на одни пятерки, лучшей ученицей в классе. На лето с бабушкой ездила на дачу. Там купалась, загорала, ходила в лес, ела ягоды и фрукты — словом, отдыхала. А когда приехала в город, и снова пошла в школу, в конце первой четверти — началось…

    — Как именно это началось? С чего?

    — Да в том-то и дело, что ни с чего. Накануне вечером все было хорошо. Василиса пришла из школы довольная, получила три пятерки, рассказала, что они будут ставить новый спектакль и Вероника Ивановна обещала ей главную роль, нормально сделала уроки (иногда она сидит допоздна, но именно в этот день все было довольно быстро), поужинала, легла спать. Утром тоже все было нормально. Встала, сделала зарядку, умылась, села завтракать. Не успела съесть кашу, как вдруг — рвота. Мы ужасно испугались, о школе, разумеется, не могло быть и речи. Вызвали врача. Врач пришел, осмотрел, помял живот, сказал: «Все нормально, никакой хирургии нет, может быть, переутомление от школы. Сдайте на всякий случай анализы и попейте витамины». А она все лето эти витамины центнерами ела. И я не врач, конечно, но какое же может быть переутомление от школы в первой четверти? Анализы мы, конечно, тут же сдали. Все нормально. Через день — опять рвота. Да какая! И опять утром. Потом — вечером. И пошло. Василиса бледная как полотно. Пытается меня успокаивать, но видно, что сама перепугана донельзя. Еще бы!

    Вот так и живем уже второй месяц. Обследовались уже у всех возможных специалистов. Нашли шумы в сердце и плоскостопие. Сами понимаете, что к нашим симптомам ни то ни другое не имеет никакого отношения. А оно то затихнет, то опять. Не знаем, что делать. Вот, посоветовали обратиться к вам.

    — Правильно ли я поняла, что Василиса по характеру всегда была аккуратной и ответственной девочкой?

    — Да, да. Она спать не ляжет, пока все уроки не выучит. И подгонять ее, как других детей, совершенно не надо. Все сама.

    — А за двойки вы Василису ругаете?

    — А у меня никогда не было двоек, — впервые подала голос сама Василиса.

    — А если бы были, как ты думаешь, мама стала бы ругаться?

    — Я думаю, что нет, — честно подумав, сказала Василиса.

    — Назови, пожалуйста, самый хулиганский поступок, который ты совершила в своей жизни. Ну, там стекло разбила или учительнице кнопку на стул подложила…

    — У меня никогда не было таких поступков, как вы говорите. Поэтому я не могу сказать… Однажды я случайно разбила бабушкин бокал, когда протирала его полотенцем.

    — Бабушка очень ругалась?

    — Нет, она совсем не ругалась. Наоборот, она меня утешала, потому что я очень плакала. Бокал был очень красивый, мне было его жалко.

    — Скажи, Василиса, а тебе снятся сны?

    — Да, конечно.

    — А кошмары среди них бывают? Ну, что за тобой кто-нибудь гонится, ты куда-нибудь падаешь или на тебя что-то падает и все такое…

    — Нет, такого я не помню. Бывает только, что я что-нибудь не успела к школе сделать или тетрадку дома забыла. Вероника Ивановна говорит: «Дети, откройте тетради». Я лезу в портфель, а у меня там вместо тетрадок яблоки лежат. С дачи. — В этом месте Василиса позволила себе осторожно улыбнуться. — Но это, наверное, не кошмар, потому что Вероника Ивановна добрая.

    — То есть она не стала бы ругать тебя за забытую тетрадь?

    — Вообще-то она иногда ругается, но на меня — никогда. А про тетрадки я не знаю, потому что никогда их не забывала. Только во сне. — Василиса улыбнулась еще раз.

    После окончания разговора я отправила Василису в другую комнату рисовать проективные рисунки.

    — Как вы думаете, что с ней такое?! — не скрывая больше своей тревоги, воскликнула мать. — Все врачи разводят руками, а мне иногда кажется, что это что-то совсем страшное. Я второй месяц по ночам не сплю, таблетки глотаю… Как вы думаете, это пройдет?

    — Я думаю, что это невроз, — сказала я. — И я думаю, что ждать, пока он сам пройдет (хотя это и возможно), не стоит. Я думаю, что его надо лечить.

    Итак, если я предполагаю, что у Василисы невроз, то должны быть налицо все его компоненты. Давайте смотреть.

    Предневрозный характер — имеет место. Василиса гиперответственна, педантична, тревожна, несмотря на все свои способности и достижения не уверена в себе («Сто раз все перепроверит»). Очень зависима от мнения окружающих, боится совершить ошибку и повести себя «не так». Характер Василисы, судя по всему, результат взаимодействия воспитания и темперамента. По темпераменту Василиса, скорее всего, флегматик, склонна все делать неторопливо и как следует. А гиперответственность, высокую требовательность к себе в ней воспитали мама и бабушка. Делать много, на совесть, да еще и все делать правильно, все успевать — это тяжело. Поэтому Василиса допоздна сидит за уроками, почти не гуляет, не посещает никаких кружков.

    Далее. Клиническая картина — более чем налицо. На первый взгляд, симптом всего один — рвота, но это только на первый взгляд. Мать в разговоре упоминала о том, что Василиса уже больше года с трудом засыпает, под глазами у нее к концу дня — синие круги, иногда плачет по пустякам, в прошлом году под бровью почти месяц дергалась какая-то «жилка» (скорее всего — тик). Итак, есть клиническая картина.

    Как обстоит дело с внутренним конфликтом? По идее на его характер должен опосредованно указывать основной симптом.

    Иногда это «указание» выглядит весьма своеобразно. Так, например, один из коллег рассказывал следующий случай. Женщина узнает о том, что ей изменяет муж. Ее принципы требуют немедленного развода. Но муж кормит ее и двоих несовершеннолетних детей. Уходить ей некуда. Специальности у нее практически нет. Но и «поступиться принципами» она тоже не может. Тогда из этой тупиковой ситуации находится выход — в болезнь. Женщина заболевает истерическим неврозом, у нее парализует обе ноги. Теперь она просто физически «не может уйти» от мужа, а симптом ясно и недвусмысленно указывает на локализацию внутреннего конфликта.

    Итак, имеющийся у нас симптом — рвота. О чем же он нам говорит? Рвота — это не тошнота, не отрыжка, не другие желудочно-кишечные расстройства. Это симптом демонстративный, сильный, внешний. Что такое рвота в представлениях отличницы и аккуратистки Василисы? Нечто грязное, непристойное, отвратительное. То, что шокирует окружающих, то, что невозможно скрыть, перетерпеть. То, чего не должно быть. Отсюда уже рукой подать до внутреннего конфликта. У Василисы воспитанием и рано присоединившимся к нему самовоспитанием подавлена и вытеснена в неосознаваемое ровно половина ее личности — та, которая отвечает за шалости, дерзости, ребячливость и прочие подобные вещи. Но Василисе всего 8 лет и даром подобные «штучки» ей не проходят. Следовательно, имеем внутренний конфликт — между сознательной установкой «все должно быть правильно, вовремя, положительно» и воплем из неосознаваемой части психики «быть всегда положительным и всегда выглядеть пристойно нельзя!». Отсюда же — «непристойный» характер симптома.

    Сложнее обстоит дело с психотравмирующей ситуацией. Ее вроде бы на горизонте нет. Считать таковой длительное напряжение и попытки делать все и всегда правильно — довольно большая натяжка. Ведь у Василисы пока все получалось. Почему же срыв произошел именно тогда, в начале первой четверти второго класса? Но и здесь есть некоторая зацепка. Когда я расспросила Василису о предполагаемом спектакле, Василиса с нескрываемой радостью сообщила мне о том, что из-за ее болезни главную роль отдали другой девочке, а ей досталась роль положительная, но малозначащая.

    — А разве не обидно, что главная роль досталась не тебе? — поинтересовалась я.

    — Нет, что вы! — очень искренне ответила Василиса (мне показалось, что лживость отнюдь не входит в число ее недостатков). — Там же столько слов надо было учить. А сейчас у меня совсем мало — всего одна страничка. Я ее уже выучила, так что мне даже на репетиции можно не ходить. Но я все равно иногда хожу, сижу в зале, слушаю.

    С некоторой натяжкой, но все же можно предположить, что Василиса, разумеется, не осознавая этого, была роковым образом «травмирована», получив еще одну почетную нагрузку — большую главную роль в новом спектакле, и именно это послужило «спусковым крючком» для развития невроза. Отсюда несколько яснее становится и момент с психологической защитой. Отвратительный симптом тем не менее позволил Василисе «отвертеться» от главной роли и существенно уменьшить ее участие в общественной работе в целом. Кроме того, возможно, что из-за болезни и сама Василиса смогла разрешить себе какие-то мелкие послабления, о которых я просто не осведомлена.

    Итак, все компоненты невроза вроде бы налицо. Пора начинать лечение. Ясно, что оно должно быть комплексным. Посоветовавшись с невропатологом, мы решили никакого медикаментозного лечения пока не проводить и ограничится психотерапией.

    Маме были выданы рекомендации поговорить с учительницей и в разговоре настаивать на следующем.

    Снять на время все общественные нагрузки с Василисы.
    Никогда и ни при каких обстоятельствах не ставить Василису в пример другим детям. При надобности хвалить лично ее, других детей совершенно не упоминая.
    Далее я посоветовала маме создать атмосферу «хулиганства» в семье, действуя по мере сил и фантазии.

    — Кидайтесь подушками, опрокиньте чернила на что-нибудь очень нужное, — серьезно советовала я, не обращая внимания на восковую бледность мамы. — Бейте посуду, получайте двойки, пишите на стенах в парадной, позвоните кому-нибудь по телефону и посоветуйте запасаться водой, так как ее скоро отключат. Через полчаса позвоните по тому же номеру и посоветуйте пускать в набранной воде кораблики.

    — Я вас поняла, — шепотом сказала мама. — Я попробую.

    С самой Василисой я работала по методу, который условно называется сказкотерапией. Ребенок при минимальном участии психотерапевта сочиняет сказку. В проблемах героев сказки, естественно, отражаются собственные проблемы ребенка. Решая их вместе с психотерапевтом, развивая и завершая сюжет, ребенок вплотную подбирается к разрешению собственного внутреннего конфликта, а значит, и к преодолению невроза. Естественно, что все так просто только на словах. На практике добраться до подлинного конфликта таким способом бывает очень нелегко. Но Василиса для «настоящей» психотерапии была еще слишком мала, а для игровой терапии слишком серьезна. Поэтому особого выбора у меня не было.

    За сочинение сказки Василиса принялась охотно. И конфликт в сказке был как на ладони — до тошноты положительная девочка Ася и ее антипод — отрицательная героиня Танька. Я уже почти торжествовала — достаточно было подружить Таньку и Асю, слить их в один персонаж, и вот уже преодоление внутреннего конфликта достигнуто и долгожданная победа над неврозом — у нас в руках. Но не тут-то было. Василиса категорически отказывалась признавать Таньку и ее достоинства. И никакие мои увертки и приемы не помогали. Бились мы почти месяц, пока наметились какие-то сдвиги.

    Тут и со стороны мамы подоспела помощь — она каким-то образом уговорила Василису положить бабушке в компот пластмассовую рыболовную муху. Да еще два раза Василиса ложилась спать, так и не приготовившись к уроку природоведения. И учительница, встревоженная состоянием девочки, честно выполняла мамины просьбы — никаких общественных нагрузок, никаких публичных похвал. Приблизительно через пять недель Василиса немного расслабилась и отвратительный симптом тут же исчез, сгинул, как будто его и не было. В это же время подошла к концу и наша «долгоиграющая сказка». На последнем сеансе Василиса призналась мне, что если бы было можно и не задавали так много уроков, то она хотела бы ходить в кружок керамики при школе. Дети там сами лепят из глины, а потом расписывают… Так красиво. Я уверила Василису, что ее мечта вполне реальна.

    Сбить цифру I | Стелла Даунер Изобразительное искусство

    Перейти к основному содержанию

    Меню

    Основная навигация

    • Домой
    • О
    • Художники
    • Выставки
    • Склад
    • Услуги
    • Новости
    • Ссылки
    • Подписаться
    • Контакт

    Рабочий субтитр

    2012

    Художник

    Стив Лопес

    Средний

    картон масло

    Рабочий размер

    40 x 50 см

    $ 1,700

    Год

    2012

    Цена

    австралийских доллара

    $ 1,700

    Статус работы

    Продается

    Параметры отображения

    Активный Показать на странице биографии

    Ранг работы

    9

    Рейтинг страницы художника

    9

    • Stella Downer Fine Art
    • Веллингтон-стрит, 1/24, Ватерлоо, 2017
    • Часы работы: вторник – пт 10–17, сб 11–17

    • T: +61 (0) 402 018 283
    • E: info @ stelladownerfineart. com.au
    • Член Ассоциации художественных галерей Австралии (AGAA)

    Меню нижнего колонтитула

    • Авторские права © Стелла Даунер Изобразительное искусство, 2021 г.
    • Ссылки
    • Условия
    • Конфиденциальность
    • Присоединиться к нашему списку рассылки
    • Отписаться от рассылки
    • Сайт разработан Norton Design

    Социальные сети

    • Instagram
    • Твиттер
    • Facebook
    Валидация антител с нокаутом и нокаутом

    | Thermo Fisher Scientific

    Тестирование эффективности антител против генетически модифицированных образцов

    Проверка * специфичности антитела имеет решающее значение для обеспечения отсутствия неспецифического связывания и, следовательно, наивысшего уровня функциональности. Тестирование эффективности антител против генетически модифицированных образцов — один из способов проверить, распознает ли антитело конкретную мишень. Это можно сделать с помощью различных методов, включая модели нокаута мышей, доминантно-отрицательные мутанты, морфолино, миРНК и, самое последнее, редактирование генов. Thermo Fisher Scientific стремится предоставить самые лучшие доступные антитела. В настоящее время мы повторно тестируем весь портфель антител Invitrogen, чтобы убедиться, что они специфичны для указанных целей.

    Расширенная проверка

    Значок расширенной проверки применяется к продуктам, прошедшим тестирование приложений и специфичности. Расширенное верификационное тестирование антител Invitrogen продолжает расширяться по всему портфолио. Антитело без значка следует рассматривать как антитело, которое еще не прошло тестирование, а не как отражение специфичности продукта. Этот значок можно найти в результатах поиска и в верхней части веб-страниц, посвященных конкретным продуктам. Данные, поддерживающие значки расширенной проверки, можно найти в галереях данных по конкретным продуктам.

    CRISPR-Cas9 в моделях нокаутных клеток

    Используя систему CRISPR-Cas9, ученые могут создавать модели нокаутных клеток, которые впоследствии могут использоваться в качестве надежных средств контроля для проверки специфичности антител. Система CRISPR-Cas9 использует некодирующую молекулу одиночной направляющей РНК (sgRNA) для «направления» CRISPR-ассоциированной эндонуклеазы Cas9 к намеченному целевому гену, где она расщепляет ДНК. Это расщепление ДНК приводит к нокауту целевого гена. Таким образом, технология CRISPR-Cas9 используется для подавления экспрессии целевого белка в соответствующих клеточных моделях, что делает его подходящим отрицательным контролем для проверки специфичности антитела (, рисунок 1, ).

    CRISPR-Cas9 также можно использовать для одновременного тестирования специфичности антител к множеству сигнальных белков в пути путем отключения экспрессии вышестоящих медиаторов. Эта возможность мультиплексирования позволяет упростить и высокопроизводительную проверку антител. Учитывая это преимущество, технология CRISPR-Cas9 становится предпочтительным решением для проверки антител путем генетической модификации.

    Рис. 1. Схема проверки специфичности антитела, опосредованной нокаутом CRISPR-Cas9.

    В приведенном ниже примере специфичность антитела была продемонстрирована путем нокаута белка-мишени, опосредованного CRISPR-Cas9. Потеря сигнала наблюдалась для белка-мишени в линии клеток с нокаутом (KO) ErbB2 (HER-2) с использованием мышиного моноклонального антитела против ErbB2 (HER-2) (каталожный номер MA5-15702).

    Рис. 2. Вестерн-блот-анализ ErbB2 (HER-2) ( Рис. 2 a ) проводили путем загрузки 30 мкг SK-BR-3 Control (дорожка 1) и SK-BR-3 ErbB2. нокаут (дорожка 2) экстракты целых клеток.ErbB2 (HER-2) был обнаружен при 185 кДа с использованием мышиного моноклонального антитела ErbB2 (HER-2) (каталожный номер MA5-15702, разведение 1: 500) и козьего антимышиного IgG (H + L) суперклонального вторичного антитела HRP. конъюгат (Кат. № A28177, разведение 1: 4000). Денситометрический анализ этого вестерн-блоттинга показан на гистограмме (, рис. 2, b, ). Потеря сигнала при нокауте, опосредованном CRISPR (KO), подтверждает, что антитело специфично к ErbB2 (HER-2).

    В приведенном ниже примере иммунофлуоресцентный анализ EGFR был проведен на 70% конфлюэнтных клетках A431 в логарифмической фазе.Специфичность антител была продемонстрирована путем нокаута целевого белка, опосредованного CRISPR-Cas9. Потеря экспрессии EGFR наблюдалась в линии клеток с нокаутом EGFR по сравнению с контрольной линией клеток с использованием моноклонального антитела EGFR (h21) (каталожный номер MA1-12693).

    Рис. 3. Клетки фиксировали 4% параформальдегидом в течение 15 минут, пропитывали 0,1% Тритоном X-100 в течение 10 минут и блокировали 1% БСА в течение 1 часа при комнатной температуре. Затем клетки метили мышиным моноклональным антителом EGFR (кат.No. MA1-12693) в концентрации 2 мкг / мл в 0,1% BSA и инкубировали в течение 3 часов при комнатной температуре, а затем метили суперклональными вторичными антителами козьих антител против мышиного IgG (H + L), конъюгатом Alexa Fluor 488 (Кат. A28175) при разведении 1: 2000 в течение 45 минут при комнатной температуре. Ядра (синие) окрашивали SlowFade Gold Antifade Mountant DAPI (каталожный № S36938). F-актин (красный) окрашивали родамином фаллоидином (каталожный № R415, 1: 300). Сигнал EGFR наблюдали в контрольной клеточной линии (панели a-d), но не в линии клеток с нокаутом EGFR (KO) (панели f-i).Панели e и j представляют соответствующие элементы управления без первичных элементов.

    Рис. 4. Рабочий процесс CRISPR-Cas9 для демонстрации специфичности антител.

    РНКи в стратегиях нокдауна

    Технология РНК-интерференции (RNAi) использует преимущества естественного механизма клетки для эффективного подавления экспрессии интересующего гена. Это широко используемый метод проверки специфичности антител.

    В клетках млекопитающих короткие фрагменты двухцепочечной РНК, иначе известные как короткие интерферирующие РНК (миРНК), инициируют деградацию или нокдаун конкретной целевой клеточной мРНК. В этом процессе антисмысловая цепь дуплекса миРНК становится частью мультибелкового комплекса, называемого РНК-индуцированным комплексом подавления (RISC). Затем RISC идентифицирует комплементарную мРНК и расщепляет ее в определенном месте. Затем это расщепленное сообщение подвергается деградации, что в конечном итоге приводит к потере экспрессии белка.

    Существуют разные методы проведения экспериментов с РНКи. РНКи может быть достигнута путем трансфекции клеток-мишеней пулом синтетических малых РНК или пулом миРНК, полученным посредством расщепления in vitro ( in vitro, разделение РНК-мишени).РНКи также может быть получена путем трансфекции клеток векторами короткой шпилечной РНК (кшРНК). shRNA процессируется внутри клетки, и siRNA, генерируемая in vivo, затем может нацеливаться на ее специфическую молекулу мРНК для деградации. Для проверки специфичности нокдауна можно использовать нецелевые элементы управления.

    Рисунок 5. Принцип siRNA-опосредованного нокдауна мРНК-мишени. На рисунке показано использование in vitro -синтезированной миРНК в типичном эксперименте с РНКи.

    В приведенном ниже примере миРНК Invitrogen Silencer Select трансфицируют в клетки в 96-луночном формате с последующей RT-qPCR.Наиболее эффективный нокдаун (в зависимости от типа клеток и условий трансфекции siRNA) определяется с помощью анализа экспрессии генов. Выбранный скрининг затем масштабируется для подтверждения специфичности антител с помощью вестерн-блоттинга и иммуноцитохимии (ICC).

    План трансфекции SiRNA

    Рис. 6. Схема стратегии нокдауна, используемой для проверки специфичности антител.

    Фигура 7. Вестерн-блоттинг для проверки антител. (A) Вестерн-блоттинг, показывающий нокдаун SMAD2 (дорожка 3) в лизатах целых клеток HeLa после трансфекции siRNA, нацеленной на SMAD2, с использованием моноклональных кроличьих антител Invitrogen SMAD2 ABfinity (каталожный № 700048). Нокдаун показан вместе с необработанной и скремблированной РНК в качестве контроля на дорожках 1 и 2 соответственно. Обнаружение актина использовали в качестве контроля загрузки. (B) Относительное количественное определение нокдауна полос SMAD2 на вестерн-блоте по сравнению с необработанной и скремблированной миРНК в качестве положительного контроля.Интенсивность каждой полосы нормализована с использованием относительной интенсивности полос актина.

    Фигура 8. Иммуноцитохимия для проверки антител: Нокдаун CHD7 был достигнут путем трансфекции клеток SH-SY5Y с помощью миРНК, специфичной для CHD7 (Silencer select Cat. No. s31140, s529331). Иммунофлуоресцентный анализ выполняли на нетрансфицированных клетках SH-SY5Y (панель a, d), трансфицированных неспецифической скремблированной siRNA (панель b, e) и CHD7-специфической siRNA (панель c, f).Клетки фиксировали, повышали проницаемость и метили поликлональным антителом CHD7 (каталожный номер PA5-72964, разведение 1: 100), затем козьим суперклональным вторичным антителом против кроличьего IgG (H + L), конъюгатом Alexa Fluor 488 (кат. № A27034, 1: 2000). Ядра (синие) окрашивали, используя ProLong Diamond Antifade Mountant с DAPI (Кат. № P36962), и Родамин Фаллоидин (Кат. № R415, 1: 300) использовали для окрашивания цитоскелета F-актином (красный). Снижение специфического сигнала наблюдали при KD, опосредованном siRNA (панель c, f), подтверждая специфичность антитела к CHD7.

    Проверка целевой специфичности антител Invitrogen с использованием генетически модифицированных образцов

    Антитела Invitrogen, которые были проверены на генетически модифицированных образцах для связывания их мишени, отмечены символом «подтвержденная специфичность» в результатах поиска и на соответствующих страницах продуктов. Данные, подтверждающие подтверждение, будут представлены на каждой странице продукта.


    * Использование или любое изменение слова «проверка» относится только к антителам с исследовательским использованием, которые были подвергнуты функциональному тестированию для подтверждения того, что антитело можно использовать с указанными исследовательскими методами. Это не гарантирует, что продукт (ы) был одобрен для клинического или диагностического использования.

    Процедура нокдауна и обоснование анализа. A, чтобы сбить ERV …

    Контекст 1

    … являются конечным результатом серии генетических событий, которые включают не только трансформацию клеток как таковую, но также модификации взаимодействий между трансформированными клетками и гостья. В частности, теперь признано, что развивающиеся опухоли возникают из-за фракции трансформированных клеток, которые приобрели способность избегать иммунного надзора (см.1–3). Молекулярные основы приобретения иммунорезистентного фенотипа до конца не изучены, хотя были описаны несколько механизмов, в том числе подавление антигенов MHC класса I (2) и повышение уровня факторов, ингибирующих апоптоз (3). В этом направлении мы ранее показали, что введение вектора экспрессии для гена оболочки (env) инфекционного мышиного ретровируса может вызвать ускользание от иммунного надзора в клетках, которые в противном случае отторгаются после приживления иммунокомпетентным мышам (4). Подобные эффекты наблюдались с геном env эндогенного ретровируса человека (ERV; ссылка 5). ERV, которые занимают большую часть геномов млекопитающих, представляют собой геномные следы древних ретровирусных инфекций, которые достигли зародышевой линии, а интегрированные провирусы затем передаются менделевским способом (см. Ссылки 6, 7). Большинство этих последовательностей накопили точечные мутации и делеции, но в геномах человека и мыши все еще есть сотни полноразмерных провирусных элементов, причем некоторые из них все еще содержат кодирующие гены, ответственные, например, за наблюдение вирусоподобных частиц. при некоторых опухолях (6, 8).Соответственно, мы предположили, что экспрессия эндогенных ретровирусов может быть вовлечена в прогрессирование опухоли in vivo, подрывая иммунный ответ. В этом отчете мы использовали линию спонтанных опухолевых клеток меланомы мыши и показали, что ERV, ретровирус, связанный с меланомой (MelARV), экспрессия которого спонтанно индуцируется в меланоме происхождения C57Bl / 6 (9), необходим для регуляторного T -клеточно-опосредованный иммунный уход из опухолевых клеток in vivo. изменить трансформированный фенотип клеток меланомы B16.Мы использовали подход РНК-интерференции, основанный на стабильных векторах, продуцирующих короткую двухцепочечную РНК, направленную против вирусного генома элемента MelARV и нерелевантного гена gfp в качестве контроля. Обоснование процедуры и структура используемых плазмид проиллюстрированы на рис. 1 A и B. Рисунок 1C ясно показывает, что ERV-специфичный вектор двухцепочечной РНК почти полностью устраняет экспрессию ERV в трансдуцированных клетках B16 (клетки ERV KD B16) с> 10-кратным снижением количества вирусных белков Env и Gag по сравнению с с контрольными трансдуцированными клетками (контрольные клетки B16).На следующем этапе трансформированный фенотип ERV KD и контрольных клеток B16 исследовали как in vitro, так и in vivo. In vitro мы измерили скорость роста, не зависящую от закрепления, после посева в полутвердую среду (анализ мягкого агара). Как показано на фиг. 2А, клеточная линия ERV KD B16 дала такое же количество колоний, что и контрольные клетки B16. In vivo мы проанализировали скорость роста двух популяций клеток после прививки мышам с рентгеновским облучением или мышам с тяжелым комбинированным иммунодефицитом. Как показано на рис.2B, обе клеточные популяции имеют трансформированный фенотип со сходной скоростью роста. В целом эти результаты показывают, что подавление эндогенного ретровируса MelARV не влияет на трансформированное состояние клеток меланомы. иммунокомпетентные хозяева. Чтобы исследовать, могут ли опухолевые клетки подавлять противоопухолевый ответ in vivo посредством ERV-зависимого механизма, мы исследовали влияние подавления MelARV на прогрессирование опухоли путем инъекции иммунокомпетентным мышам C57BL / 6 с контролем и клетками ERV KD B16.Как показано на фиг. 3A, рост контрольных клеток B16, как и ожидалось, приводил к большим опухолям у большинства животных, тогда как клетки ERV KD B16 давали опухоли ограниченного размера и только у небольшого числа привитых мышей. Разница в росте опухолевых клеток также четко подтверждается степенью выживаемости животных (рис. 3B): уже на 70-й день 90% мышей, которым были привиты контрольные клетки B16, были убиты своей опухолью, тогда как 80% мышей, которым были привиты клетки ERV KD B16, были живы и не имели опухолей (и все еще оставались такими на 130 день).В попытке идентифицировать гены MelARV, участвующие в наблюдаемых эффектах, мы ввели обратно в клетки ERV KD B16 вектор экспрессии (без двухцепочечной РНК-целевой последовательности) для единственного гена env MelARV. Затем полученные дважды трансдуцированные клетки ERV KD + env (или контрольные) B16 прививали мышам C57BL / 6. Как проиллюстрировано на фиг. 3C, это привело к частичной реверсии эффекта нокдауна, причем уже 50% мышей с привитыми Env-экспрессирующими клетками погибали к 70 дню.Эта реверсия указывает на то, что ген env, по крайней мере частично, ответственен за ускользание от опухоли. Частичный эффект реверсии, скорее всего, объясняется более низкой экспрессией (дополнительный рис. S1) белка Env при экспрессии экзогенным вектором. восстанавливает опухолевую прогрессию клеток ERV B16. Сообщалось, что для роста опухоли B16 in vivo необходимо присутствие регуляторных Т-клеток (14, 15). С другой стороны, вирусы лейкемии мышей, тесно связанные с MelARV, также, как было показано, индуцируют регуляторные Т-клетки (16, 17).Таким образом, можно предположить, что экспрессия ERV меланомой B16 непосредственно отвечает за индукцию регуляторных Т-клеток, что приводит к прогрессированию опухоли. Чтобы проверить эту проблему, мы попытались дополнить снижение опухолевой прогрессии клеток ERV KD B16 адоптивным переносом регуляторных Т-клеток CD4 + CD25 +, выделенных от мышей C57BL / 6, прививаемых клетками B16 дикого типа. Как показано на фиг.4, перенос этих CD4 + CD25 + клеток не повлиял на прогрессирование опухоли привитых контрольных клеток B16 (фиг.4 A, слева и B), но увеличивал рост опухолевых клеток ERV KD B16 до уровней, аналогичных уровням контрольных клеток B16 (рис. 4 A, справа и B). Эти результаты, таким образом, убедительно свидетельствуют о том, что регуляторные Т-клетки являются необходимыми промежуточными продуктами для опосредованного ERV эффекта. Заключение и перспективы. Настоящие данные показывают, что опухоли способны подавлять иммунную систему, экспрессируя оболочку ERV. Блокирование экспрессии ERV приводило к усиленному отторжению опухоли, а экспрессия единственного белка оболочки ERV частично восстанавливала исходную степень прогрессирования опухоли.Мы также показываем, что регуляторных Т-клеток достаточно, чтобы линия опухолевых клеток, лишенная экспрессии ERV, могла развиваться в опухоль. В более общем плане результаты также предполагают, что опухолевые клетки, вероятно, подлежат иммуноредактированию, концепция, разработанная Dunn et al. (1) и относящиеся к иммунному надзору, как первоначально описано Burnet и Thomas (18). В самом деле, мы иллюстрируем, что развитие опухоли включает не только мутации в классических протоонкогенах или антионкогенах, но также включает активные процессы, нацеленные на непредвиденные гены, которые не влияют на состояние трансформации как таковые, такие как идентифицированный в настоящее время ген MelARV. В сочетании с классической химиотерапией или лучевой терапией, нацеливание на такие гены любыми доступными способами, включая инъекцию невекторизованной малой интерферирующей РНК, может способствовать регрессии опухоли за счет восстановления естественной способности иммунной системы отторгать опухолевые клетки и, следовательно, способствовать развитию рака. лечение. В этой связи интересно, что первая серия экспериментов с использованием синтетической малой интерферирующей РНК, нацеленной на MelARV, и инъекции i.p. Через 12 дней после приживления клеток B16 иммунокомпетентным мышам это фактически привело к ингибированию роста опухоли на одну треть по сравнению с мышами, которым вводили контрольную малую мешающую РНК, и, как показано на дополнительном рис.S2 — умеренное, но воспроизводимое увеличение задержки выживания. Наконец, следует отметить, что у людей экспрессия генов env ERV, в основном ограниченная плацентой и семенником в нормальных тканях, может наблюдаться при нескольких типах опухолей, таких как семиномы и меланомы (8, 19, 20). Более того, некоторые из полностью кодирующих генов env, которые могут быть идентифицированы в геноме человека, являются иммуносупрессивными in vivo в тесте на мышиной модели (5) и, таким образом, могут действовать как ген env MelARV, способствуя ускользанию от опухоли.Дальнейшая работа теперь должна быть направлена ​​на определение возможной роли таких генов у человека …

    Контекст 2

    … se, но также модификации взаимодействий между трансформированными клетками и хозяином. В частности, теперь признано, что развивающиеся опухоли возникают из-за фракции трансформированных клеток, которые приобрели способность избегать иммунного надзора (см.1–3). Молекулярные основы приобретения иммунорезистентного фенотипа до конца не изучены, хотя были описаны несколько механизмов, в том числе подавление антигенов MHC класса I (2) и повышение уровня факторов, ингибирующих апоптоз (3). В этом направлении мы ранее показали, что введение вектора экспрессии для гена оболочки (env) инфекционного мышиного ретровируса может вызвать ускользание от иммунного надзора в клетках, которые в противном случае отторгаются после приживления иммунокомпетентным мышам (4). Подобные эффекты наблюдались с геном env эндогенного ретровируса человека (ERV; ссылка 5). ERV, которые занимают большую часть геномов млекопитающих, представляют собой геномные следы древних ретровирусных инфекций, которые достигли зародышевой линии, а интегрированные провирусы затем передаются менделевским способом (см. Ссылки 6, 7). Большинство этих последовательностей накопили точечные мутации и делеции, но в геномах человека и мыши все еще есть сотни полноразмерных провирусных элементов, причем некоторые из них все еще содержат кодирующие гены, ответственные, например, за наблюдение вирусоподобных частиц. при некоторых опухолях (6, 8).Соответственно, мы предположили, что экспрессия эндогенных ретровирусов может быть вовлечена в прогрессирование опухоли in vivo, подрывая иммунный ответ. В этом отчете мы использовали линию спонтанных опухолевых клеток меланомы мыши и показали, что ERV, ретровирус, связанный с меланомой (MelARV), экспрессия которого спонтанно индуцируется в меланоме происхождения C57Bl / 6 (9), необходим для регуляторного T -клеточно-опосредованный иммунный уход из опухолевых клеток in vivo. изменить трансформированный фенотип клеток меланомы B16.Мы использовали подход РНК-интерференции, основанный на стабильных векторах, продуцирующих короткую двухцепочечную РНК, направленную против вирусного генома элемента MelARV и нерелевантного гена gfp в качестве контроля. Обоснование процедуры и структура используемых плазмид проиллюстрированы на рис. 1 A и B. Рисунок 1C ясно показывает, что ERV-специфичный вектор двухцепочечной РНК почти полностью устраняет экспрессию ERV в трансдуцированных клетках B16 (клетки ERV KD B16) с> 10-кратным снижением количества вирусных белков Env и Gag по сравнению с с контрольными трансдуцированными клетками (контрольные клетки B16).На следующем этапе трансформированный фенотип ERV KD и контрольных клеток B16 исследовали как in vitro, так и in vivo. In vitro мы измерили скорость роста, не зависящую от закрепления, после посева в полутвердую среду (анализ мягкого агара). Как показано на фиг. 2А, клеточная линия ERV KD B16 дала такое же количество колоний, что и контрольные клетки B16. In vivo мы проанализировали скорость роста двух популяций клеток после прививки мышам с рентгеновским облучением или мышам с тяжелым комбинированным иммунодефицитом. Как показано на рис.2B, обе клеточные популяции имеют трансформированный фенотип со сходной скоростью роста. В целом эти результаты показывают, что подавление эндогенного ретровируса MelARV не влияет на трансформированное состояние клеток меланомы. иммунокомпетентные хозяева. Чтобы исследовать, могут ли опухолевые клетки подавлять противоопухолевый ответ in vivo посредством ERV-зависимого механизма, мы исследовали влияние подавления MelARV на прогрессирование опухоли путем инъекции иммунокомпетентным мышам C57BL / 6 с контролем и клетками ERV KD B16.Как показано на фиг. 3A, рост контрольных клеток B16, как и ожидалось, приводил к большим опухолям у большинства животных, тогда как клетки ERV KD B16 давали опухоли ограниченного размера и только у небольшого числа привитых мышей. Разница в росте опухолевых клеток также четко подтверждается степенью выживаемости животных (рис. 3B): уже на 70-й день 90% мышей, которым были привиты контрольные клетки B16, были убиты своей опухолью, тогда как 80% мышей, которым были привиты клетки ERV KD B16, были живы и не имели опухолей (и все еще оставались такими на 130 день).В попытке идентифицировать гены MelARV, участвующие в наблюдаемых эффектах, мы ввели обратно в клетки ERV KD B16 вектор экспрессии (без двухцепочечной РНК-целевой последовательности) для единственного гена env MelARV. Затем полученные дважды трансдуцированные клетки ERV KD + env (или контрольные) B16 прививали мышам C57BL / 6. Как проиллюстрировано на фиг. 3C, это привело к частичной реверсии эффекта нокдауна, причем уже 50% мышей с привитыми Env-экспрессирующими клетками погибали к 70 дню.Эта реверсия указывает на то, что ген env, по крайней мере частично, ответственен за ускользание от опухоли. Частичный эффект реверсии, скорее всего, объясняется более низкой экспрессией (дополнительный рис. S1) белка Env при экспрессии экзогенным вектором. восстанавливает опухолевую прогрессию клеток ERV B16. Сообщалось, что для роста опухоли B16 in vivo необходимо присутствие регуляторных Т-клеток (14, 15). С другой стороны, вирусы лейкемии мышей, тесно связанные с MelARV, также, как было показано, индуцируют регуляторные Т-клетки (16, 17).Таким образом, можно предположить, что экспрессия ERV меланомой B16 непосредственно отвечает за индукцию регуляторных Т-клеток, что приводит к прогрессированию опухоли. Чтобы проверить эту проблему, мы попытались дополнить снижение опухолевой прогрессии клеток ERV KD B16 адоптивным переносом регуляторных Т-клеток CD4 + CD25 +, выделенных от мышей C57BL / 6, прививаемых клетками B16 дикого типа. Как показано на фиг.4, перенос этих CD4 + CD25 + клеток не повлиял на прогрессирование опухоли привитых контрольных клеток B16 (фиг.4 A, слева и B), но увеличивал рост опухолевых клеток ERV KD B16 до уровней, аналогичных уровням контрольных клеток B16 (рис. 4 A, справа и B). Эти результаты, таким образом, убедительно свидетельствуют о том, что регуляторные Т-клетки являются необходимыми промежуточными продуктами для опосредованного ERV эффекта. Заключение и перспективы. Настоящие данные показывают, что опухоли способны подавлять иммунную систему, экспрессируя оболочку ERV. Блокирование экспрессии ERV приводило к усиленному отторжению опухоли, а экспрессия единственного белка оболочки ERV частично восстанавливала исходную степень прогрессирования опухоли.Мы также показываем, что регуляторных Т-клеток достаточно, чтобы линия опухолевых клеток, лишенная экспрессии ERV, могла развиваться в опухоль. В более общем плане результаты также предполагают, что опухолевые клетки, вероятно, подлежат иммуноредактированию, концепция, разработанная Dunn et al. (1) и относящиеся к иммунному надзору, как первоначально описано Burnet и Thomas (18). В самом деле, мы иллюстрируем, что развитие опухоли включает не только мутации в классических протоонкогенах или антионкогенах, но также включает активные процессы, нацеленные на непредвиденные гены, которые не влияют на состояние трансформации как таковые, такие как идентифицированный в настоящее время ген MelARV. В сочетании с классической химиотерапией или лучевой терапией, нацеливание на такие гены любыми доступными способами, включая инъекцию невекторизованной малой интерферирующей РНК, может способствовать регрессии опухоли за счет восстановления естественной способности иммунной системы отторгать опухолевые клетки и, следовательно, способствовать развитию рака. лечение. В этой связи интересно, что первая серия экспериментов с использованием синтетической малой интерферирующей РНК, нацеленной на MelARV, и инъекции i.p. Через 12 дней после приживления клеток B16 иммунокомпетентным мышам это фактически привело к ингибированию роста опухоли на одну треть по сравнению с мышами, которым вводили контрольную малую мешающую РНК, и, как показано на дополнительном рис.S2 — умеренное, но воспроизводимое увеличение задержки выживания. Наконец, следует отметить, что у людей экспрессия генов env ERV, в основном ограниченная плацентой и семенником в нормальных тканях, может наблюдаться при нескольких типах опухолей, таких как семиномы и меланомы (8, 19, 20). Более того, некоторые из полностью кодирующих генов env, которые могут быть идентифицированы в геноме человека, являются иммуносупрессивными in vivo в тесте на мышиной модели (5) и, таким образом, могут действовать как ген env MelARV, способствуя ускользанию от опухоли.Дальнейшая работа теперь должна быть направлена ​​на определение возможной роли таких генов у человека …

    Руководители Санта-Фе выясняют, как двигаться дальше после протеста на площади Санта-Фе

    Когда его спросили, почему на площади больше не было офицеров, когда ситуация начала накаляться, начальник полиции Санта-Фе сказал, что они специально вывели офицеров

    «Наблюдатели связались с дежурным командиром. Этот командир решил покинуть площадь и не взаимодействовать с кем-либо еще, если чья-то жизнь не окажется в опасности», — сказал начальник SFPD Эндрю Падилла.«На этот раз сохранение жизни важнее собственности. Я поддерживаю решение этого командира. Это правильное решение. Если бы я был начальником или командиром, мы бы приняли такое же решение. Многие люди задаются вопросом, что мы должны были использовать там слезоточивый газ, стрелять в людей резиновыми пулями, перцовым баллончиком или слезоточивым газом. Это бы прервало жизнь туристов, зевак. Просто гуляю по площади, просто гадаю, что происходит ».

    Вождь

    Падилья сказал, что они координируют свои действия с другими агентствами, чтобы помочь идентифицировать людей, которые принимали участие в свержении обелиска.

    «Мы согласовали действия с полицией штата и департаментом шерифа. Если они получат какие-либо подсказки или информацию относительно этого инцидента, они собираются привлечь к ответственности, извините, поделитесь информацией с нашим отделом как агентством, занимающимся обработкой, чтобы мы могли привлечь к ответственности этих лиц », — сказал он.

    В течение нескольких месяцев городские власти заявляли, что собираются разработать план по удалению обелиска и других спорных памятников в Санта-Фе. Мэр Санта-Фе Алан Уэббер сказал, что хочет провести диалог с сообществом о том, как двигаться дальше.

    «Руководящий орган в целом сказал очень громким и ясным голосом, что нам нужно быстро двигаться вперед, чтобы удовлетворить эту потребность сообщества в диалоге», — сказал мэр. «Ясно, что люди хотят, чтобы их слышали. Они хотят, чтобы их голоса были услышаны. Они хотят, чтобы интересы их племен были представлены. Они хотят, чтобы история города была широко представлена ​​».

    KOB 4 не смог взять интервью у лидеров Санта-Фе во вторник, но продолжит требовать от них ответов в текущей ситуации.

    Кто был Эдвард Колстон, деятель работорговли, памятник которому британские демонстранты сбили с ног?

    ДЖАКАРТА — Джордж Флойд, чернокожий мужчина, погибший из-за того, что белый полицейский прижал его шею коленом, вызвал протесты против расовой несправедливости во всем мире. Во время заключительной церемонии дани перед похоронами Флойда говорят, что Флойд был «обычным братом», которого судьба превратила в «основу движения».

    Как сообщает CNN в среду, 10 июня, инцидент со смертью Флойда вызвал протесты против расизма в различных странах, одной из которых была Великобритания. Даже протестующие в Бристоле, Англия, связали бронзовую статую Эдварда Колстона веревкой, прежде чем бросить ее в окружающую толпу, которую они бросили в реку.

    Протестующие отметили крушение статуи Эдварда Колстона. Однако противники бюста Эдварда Колстона утверждали, что это был вандализм и попытка стереть историю.Местная полиция сообщила, что по факту происшествия начато расследование.

    «Есть небольшая группа людей, которые явно совершили преступление, сбив статую возле порта Бристоля. Будет проведено расследование для установления личности причастных к этому, и мы собрали кадры инцидента», — заявила полиция.

    Статуя Колстона стоит в центре Бристоля с 1895 года. Статуя становится все более спорной, и подаются петиции с требованием ее удаления.

    Кто такой Эдвард Колстон?

    Официальный сайт Бристольского музея описывает Колстона как «оскорбленного филантропа / работорговца». Говорят, что Колстон родился в городе в 1636 году, но прожил в Лондоне. Он стал активным членом руководящего органа RAC (Королевской африканской компании), которая торговала рабами из Африки в Америку.

    RAC также отправила в рабство больше мужчин, женщин и детей, чем любая другая компания в истории работорговли.Известно, что в период с 1672 по начало 1720-х годов RAC перевозил почти 150 000 человек.

    К этому времени Колстон быстро продвигался по служебной лестнице в RAC. Подсчитано, что за время его пребывания на посту заместителя губернатора компании с 1680 по 1692 год на корабле RAC было перевезено до 84000 порабощенных африканцев. Во время путешествия почти четверть этих людей или около 19 тысяч человек погибли в пути, не дойдя до побережья.

    Все рабы были заклеймены на груди инициалами RAC; в том числе дети в возрасте от шести лет. Каждый четвертый ребенок умирает в пути. Условия на лодке были переполненными и антисанитарными, что привело к распространению смертельных заболеваний.

    «Изображение Эдварда Колстона было очень спорным и оскорбительным для многих, и, отбрасывая его (статую Колстона), важно отметить, что мы не стираем историю, а творим ее», — говорится в заявлении Международного музея рабства.

    Затем Колстон покинул RAC и стал членом парламента от партии Тори, представляющей Бристоль, где он защищал «право» города «продавать» порабощенных африканцев.В последние годы своей жизни он стал крупным инвестором другой компании по работорговле, компании South Seas Company (SSC), которая в основном торговала с Южной Америкой.

    За время сотрудничества Колстона с SSC компания перевезла около 15 931 африканца в рабство, причем почти каждый пятый погиб в пути. С другой стороны, Колстон также заработал репутацию филантропа.

    Он пожертвовал большую часть своего состояния на благотворительные цели, такие как строительство школ и больниц в Бристоле и Лондоне. Его филантропический характер заставил имя Колстона проникнуть в Бристоль. Помимо статуи, есть частная школа Colston’s.

    Есть также концертный зал под названием Colston Hall, многоэтажный офисный блок под названием Colston Tower и Colston Street. Хотя показано, что Колстон имеет связи с африканской работорговлей, Бристольский музей объясняет, что работорговля «не была исключительно его желанием».

    Для некоторых в 19 веке Колстон олицетворял честь большого богатства, патернализм как оплот против социализма и благотворительность.Рабство, в котором было построено его богатство, скрыто для конкретного повествования истории Бристоля. Свержение и затопление статуи — подтверждение нового исторического письма.


    Версии на английском, китайском, японском, арабском, французском и испанском языках создаются системой автоматически. Поэтому при переводе все еще могут быть неточности, пожалуйста, всегда выбирайте индонезийский в качестве основного языка. (система поддерживается DigitalSiber.id)

    Knock down анализ выявляет критические фазы для специфических функций некодирующих oskar РНК во время оогенеза дрозофилы | G3 Гены | Геномы | Генетика

    Аннотация

    Транскрипт oskar , действуя как некодирующая РНК, способствует разнообразному набору путей в яичнике Drosophila , включая образование кариосом, расположение центра организации микротрубочек (MTOC), целостность определенных частиц рибонуклеопротеина, контроль кормления грудью. деления клеток, ограничение нескольких белков зародышевой линией и прохождение оогенеза.Как мРНК oskar выполняет эти функции, остается неясным. Здесь мы используем подход «нокдауна» для определения критических фаз, когда oskar требуется для трех из этих функций. Существующая трансгенная кшРНК для удаления мРНК oskar в зародышевой линии нацелена на последовательность, перекрывающуюся регуляторный сайт, связанный с белком Bruno1, чтобы обеспечить репрессию трансляции, и была неэффективной во время оогенеза. Новые трансгенные кшРНК, нацеленные на другие сайты, были эффективны при сильном снижении уровней мРНК oskar и воспроизводстве фенотипов, связанных с отсутствием мРНК.Используя драйверы GAL4, активные на разных стадиях развития оогенеза, мы обнаружили, что ранняя потеря мРНК oskar воспроизводит дефекты в формировании кариосом и позиционировании MTOC, но не останавливает оогенез. Потеря мРНК oskar на более поздних стадиях необходима для предотвращения прогрессирования через оогенез. Таким образом, некодирующая функция мРНК oskar требуется для более чем одного события.

    Введение

    Drosophila oskar ( osk ) мРНК необходима, независимо от белка Osk, во время оогенеза (Jenny et ​​al. 2006). Мутанты, в которых уровни мРНК или существенно снижены или устранены, обнаруживают множество дефектов. Наиболее заметным из них является женское бесплодие, являющееся следствием остановки оогенеза. Еще до остановки появляются более тонкие дефекты: в яйцевых камерах часто бывает слишком много питательных клеток, конденсация хромосом ооцита для образования кариосомы неполная, расположение центра организации микротрубочек (MTOC) в ооците ненормальное, некоторые частицы рибонуклеопротеинов находятся в неправильном положении. дезорганизованы, и белки, обычно ограниченные клетками зародышевой линии яичника, могут быть обнаружены на низких уровнях в окружающих соматических фолликулярных клетках (Jenny et ​​al. 2006; Канке и др. 2015; Kenny et ​​al. 2021 г.). Обнаружение дополнительных дефектов кажется вероятным, поскольку остается только применить соответствующие анализы. Разнообразие фенотипов или нуль-мутантных РНК без видимой общей зависимости от конкретного клеточного пути ниже или , может указывать на существование множества различных некодирующих функций. Однако каждый из перечисленных выше фенотипов чувствителен к мутации одних и тех же определенных функциональных последовательностей в 3 ‘UTR мРНК osk : плотно кластерная комбинация сайтов связывания Bruno1 (Bru1), некодирующего элемента osk (ONCE) и A -богатые последовательности (ARS) (Vazquez-Pianzola et ​​al. 2011; Канке и др. 2015; Kenny et ​​al. 2021 г.). Таким образом, эти элементы либо опосредуют несколько событий или взаимодействий, либо выполняют одну функцию с несколькими путями, на которые влияет нарушение этого события. Крайняя версия последнего варианта будет исходным событием «ворот» с немедленным исходом, таким как образование кариосом или правильная организация MTOC, что является предпосылкой для более поздних результатов, таких как прогрессия через оогенез.

    Один из подходов к исследованию взаимосвязи различных или RNA null дефектов состоит в том, чтобы нарушить активность или ncRNA на разных стадиях оогенеза и спросить, могут ли определенные дефекты индуцироваться отдельно от других. Классическое применение этой стратегии часто основывалось на чувствительных к температуре мутантах (, например, , Jarvik and Botstein 1973). Более поздний подход к этой концепции основан на индуцибельной активации или подавлении гена (например, , Gossen and Bujard 1992; Gossen et ​​al. 1995; Kumar et ​​al. 2009; Fenno et ​​al. 2011). В Drosophila полезным методом является нокдаун генов (KD), основанный на трансгенных shРНК под контролем UAS / GAL4 (https: // fgr.hms.harvard.edu/fly-in-vivo-rnai) и различные драйверы GAL4 (Brand and Perrimon, 1993) с разными временными и / или пространственными паттернами выражения.

    Здесь мы использовали подход KD, начав с разработки эффективных трансгенов osk -shRNA, чтобы устранить ограничение, приводящее к отключению существующих версий. Мы предоставляем доказательства различных критических периодов для различных ролей нкРНК osk и показываем, что начальные дефекты от ранней потери мРНК osk не имеют длительного эффекта, если мРНК osk восстанавливается.

    Материалы и методы

    Мухи и трансгены

    Для конструирования трансгенов osk-shRNA пары олигонуклеотидов отжигали и клонировали в сайты Nhe I и Eco RI вектора VALIUM22. Пары олигонуклеотидов, все показанные 5 ’слева: osk-shRNA № 1 , CTAGCAGTACGATTCTCTGCTGACGATTATAGTTATATTCAAGCATATAATCGTCAGCAGAGAATCGTGCG и AATCTGCACGATTCTCGAATCGATAGACG и AATCTGCACGATTCTCGAATGATAGACTCAG и AATCTGCACGATTCTCGATGATGACTGAC; оск-шРНК № 2 , CTAGCAGTAAGGAGATGCACAATATGCGATAGTTATATTCAAGCATATCGCATATTGTGCATCTCCTTGCG и AATTCGCAAGGAGATGCACAATATGCGATATGCTTGAATATAGCACAATATGCGATATGCTTGAATATAGCACTTGCGCTTGAATATAGCACTGCGC оск-шРНК № 3 , CTAGCAGTTCGACATACACTCCTGTCTAATAGTTATATTCAAGCATATTAGACAGGAGTGTATGTCGAGCG и AATTCGCTCGACATACACTCCTGTCTAATATGCTTGAATATAACTATTAGACTCAGGAGTGTATAT.Дизайн shRNA был великодушно выполнен Клэр Янху Ху из TRiP, Гарвардская медицинская школа. Каждый трансген вставляли в сайт attP40 на 25С6 (запас Bloomington # 25709).

    Трансгенный штамм TRiP для KD osk был TRiP.GL01101, запас Bloomington # 36903, а для KD bru1 был TRiP.GL00314, Stock Bloomington # 35394.

    Трансген osk syn был основан на спасающем геномном трансгене (Kim-Ha et ​​al. 1991), в котором часть гена osk от 3 ‘до начала второго экзона до стоп-кодон (координаты 8935984–8937367 в выпуске r6.40 из геномной последовательности D. melanogaster ) была заменена синтетической последовательностью, сохраняющей последовательности интронов дикого типа и кодирующей последовательность белка Osk дикого типа, но синонимичными кодонами для максимизации различий в последовательности ДНК (см. Дополнительный файл S1). Координаты геномной последовательности Drosophila были получены из FlyBase (Larkin et ​​al. 2021).

    Были описаны аллели osk, osk 0 , и osk N (Kanke et ​​al. 2015; Mohr et ​​al. 2021 г.). Драйверы GAL4 от Bloomington Stock Center: (с использованными здесь сокращениями в скобках) P (GAL4 :: VP16-nos.UTR) CG6325 [MVD1] ( NGV ), BL # 4937; P (matalpha4-GAL-VP16) V37 ( MAT ), BL # 7063; P (GAL4-номера .NGT) 40 ( NGT ), BL № 4442. Дополнительные драйверы GAL4 из коллекции Janelia Research Campus (также известные как «линии Rubin GAL4»), 12B02 , 25D06 , 29E01 и 34C10 , были получены от Allan Spradling.Они были среди группы, которую он определил, когда его спросили, проверила ли его лаборатория с положительными результатами какую-либо коллекцию Janelia на активность в яичниках.

    Анализы откладки яиц выполняли, как описано (Kenny et ​​al. 2021).

    Обнаружение РНК и белков

    Уровни

    РНК определяли с помощью кПЦР, как описано (Kenny et ​​al. 2021). Гибридизация in situ для обнаружения мРНК или с использованием черепичных коротких олигонуклеотидов ДНК (smFISH) 3 -конца, меченных флуорофором Quasar 670 (LGC Biosearch Technologies) и используемых на этапе 1.5 нМ. Анализы выполняли, как описано (Abbaszadeh and Gavis 2016). Иммунодетекция белков в яичниках была описана (Ryu and Macdonald 2015) с другим протоколом фиксации для гамма-тубулина (Kenny et ​​al. 2021). Иодид TO-PRO-3 (Invitrogen) (1: 1000) или DAPI (1: 4000) использовали для окрашивания ДНК. Антитела для визуализации представляли собой мышиное анти-1B1, которое обнаруживает белок аддуцин (Hts) (банк гибридом развивающихся исследований), разведенный 1: 1, мышиный анти-ламин Dm0 (ADL84.12) (банк гибридом исследований развития), разведенный 1: 100, и кроличий анти-гамма-тубулин (Sigma T-0950), разведенный 1: 2000.Образцы получали с помощью лазерного сканирующего конфокального микроскопа Nikon C2 +. Для всех экспериментов по визуализации образцы были получены как минимум от пяти мух, как правило, от многих других. Количественная оценка данных гибридизации in situ была проведена в FIJI, при этом были отслежены зародышевые клетки или камеры для яиц и измерена максимальная интенсивность пикселей. Измерения площадей ооцитов, ограниченных очагами гамма-тубулина, проводили, как описано (Kenny et ​​al. 2021).

    Статистические методы

    Воспроизводимость подтверждена независимыми экспериментами.Эксперименты по визуализации включали изучение нескольких отдельных яичных камер в каждом эксперименте. Здесь повторение служило для выявления любых технических проблем, а большое количество отдельных яичных камер, оцениваемых в каждом эксперименте, обеспечивало согласованность и воспроизводимость. Эксперименты по откладке яиц проводили не менее трех раз. Скорость откладки яиц часто показывает циркадные колебания, но поскольку каждый эксперимент состоял из сбора яиц в течение нескольких дней, этот источник отклонений был минимизирован. Эксперименты не были рандомизированы, и статистический метод не использовался для предварительного определения размера выборки. Односторонний дисперсионный анализ ANOVA использовался, чтобы спросить, есть ли существенные различия между наборами данных с тремя или более переменными. Для всех анализов критерии Шапиро-Уилка отклонили нормальность, а критерии суммы рангов Вилкоксона использовались для апостериорного анализа .

    Результаты и обсуждение

    Разработка и валидация новых реагентов

    osk KD

    Один из подходов к определению критической фазы или фаз активности или нкРНК заключается в удалении или РНК путем нокдауна (KD), полагаясь на драйверы GAL4 с различной временной активностью для экспрессии трансгенной shРНК, которая нацелена на или мРНК.Однако материнский тройной драйвер ( MTD-Gal4 ) в сочетании с трансгенным реагентом osk shRNA для экспрессии зародышевой линии (TRiP.GL01101) из Transgenic RNAi Project (TRiP) неэффективен для имитации наиболее впечатляющего osk РНК-нулевой фенотип, остановка оогенеза, так как откладка яиц существенно не снижается (Liu and Lasko 2015). Точно так же драйвер matalpha4-GAL-VP16 (далее именуемый MAT ; сокращения, используемые для других драйверов, приведены в разделе «МАТЕРИАЛЫ И МЕТОДЫ») в сочетании с TRiP.GL01101 лишь незначительно снизил уровень мРНК или яичников (рис. 1B) и не смог существенно снизить яйценоскость (рис. 1C).

    Рисунок 1

    Нокдаун или мРНК в оогенезе. (A) Схема гена osk , показывающая положения сайтов-мишеней osk-shRNA . Последовательности РНК непосредственно ниже показывают перекрытие между сайтом связывания Bru1 (BRE) и целью osk-shRNA (GL01101) проекта TRiP . Последовательности РНК внизу показывают последовательности, мутировавшие (красный цвет) в трансгене osk syn на участке мишени osk-shRNA # 3 , с нуклеотидами, расположенными по кодонам.(B) Уровни мРНК osk , проанализированные с помощью кПЦР, из яичников самок, в которых присутствовал драйвер MAT GAL4 в комбинации с указанным osk-shRNA . Планки погрешностей указывают стандартные отклонения. (C) Скорость откладки яиц самками, в которых драйвер MAT GAL4 присутствовал в комбинации с указанным osk-shRNA , за исключением генотипа osk N / osk N . Для образца, протестированного в присутствии трансгена osk syn , фон osk был osk N / osk + , чтобы компенсировать трансгенную копию osk .Значения выше 3 яиц на самку в час усечены (конец полосы зазубрен): поголовье w 1118 , используемое в качестве контроля дикого типа, часто имеет немного более низкую скорость откладки яиц, чем различные экспериментальные штаммы. (D) Овариолы, показывающие время остановки оогенеза у мутанта osk и KD. Масштабная линейка 100 мкм.

    Рисунок 1

    Нокдаун мРНК osk в оогенезе. (A) Схема гена osk , показывающая положения сайтов-мишеней osk-shRNA . Последовательности РНК непосредственно ниже показывают перекрытие между сайтом связывания Bru1 (BRE) и целью osk-shRNA (GL01101) проекта TRiP . Последовательности РНК внизу показывают последовательности, мутировавшие (красный цвет) в трансгене osk syn на участке мишени osk-shRNA # 3 , с нуклеотидами, расположенными по кодонам. (B) Уровни мРНК osk , проанализированные с помощью кПЦР, из яичников самок, в которых присутствовал драйвер MAT GAL4 в комбинации с указанным osk-shRNA .Планки погрешностей указывают стандартные отклонения. (C) Скорость откладки яиц самками, в которых драйвер MAT GAL4 присутствовал в комбинации с указанным osk-shRNA , за исключением генотипа osk N / osk N . Для образца, протестированного в присутствии трансгена osk syn , фон osk был osk N / osk + , чтобы компенсировать трансгенную копию osk . Значения выше 3 яиц на самку в час усечены (конец полосы зазубрен): поголовье w 1118 , используемое в качестве контроля дикого типа, часто имеет немного более низкую скорость откладки яиц, чем различные экспериментальные штаммы. (D) Овариолы, показывающие время остановки оогенеза у мутанта osk и KD. Масштабная линейка 100 мкм.

    Возможные объяснения слабой KD включают недостаточную активность драйвера или ограниченную эффективность shRNA во время оогенеза. Примечательно, что сайт-мишень shRNA osk существенно перекрывается с сайтом связывания белка Bru1 (рис. 1A), который действует в регуляции трансляции мРНК osk (Kim-Ha et ​​al. 1995; Reveal et ​​al. 2010). Bru1 присутствует на самых ранних стадиях оогенеза (Webster et ​​al. 1997), и когда он связан с мРНК osk , он может мешать связыванию shРНК, тем самым ограничивая эффект KD.

    Три новых трансгена для экспрессии shРНК, нацеленных на другие сайты в мРНК osk , были изготовлены и протестированы ( osk-shRNAs № 1 , № 2 и № 3 ; Рисунок 1A). Используя драйвер MAT для экспрессии, каждая новая osk-shRNA резко снижала уровни мРНК osk (Рисунок 1B) и в значительной степени устраняла производство яиц (Рисунок 1C).Чтобы подтвердить специфичность для мРНК osk , KD с osk-shRNA # 3 был протестирован в присутствии трансгена osk osk syn с синонимичными изменениями кодона, которые изменяют osk-shRNA # 3. целевой сайт (рис. 1A): откладка яиц была восстановлена ​​(рис. 1C). Трансген osk-shRNA # 3 использовали во всех последующих экспериментах с osk кД.

    Контрастные свойства исходной osk-shRNA и новой osk-shRNA решительно поддерживают идею о том, что Bru1 может нарушать связывание shRNA, когда их мишени в мРНК перекрываются.Было бы неудивительно, если бы подобный эффект лежал в основе подмножества других неэффективных shRNA, и компиляции эффективности shRNA могли потенциально быть добыты для информации, способствующей идентификации сайтов узнавания для других белков, связывающих РНК.

    Эффективность драйверов GAL4 в снижении

    osk активности нкРНК

    Несколько драйверов GAL4, активных в женской зародышевой линии, были протестированы с osk-shRNA № 3 для мониторинга эффектов на активность osk ncRNA, сосредоточив внимание первоначально на кладке яиц (рис. 2A).Для сравнения также были выполнены КД брю1 . Самки, мутантные по сильным аллелям bru1 , не производят яиц и обнаруживают раннюю остановку оогенеза, ожидаемого фенотипа для эффективного KD.

    Рисунок 2

    Сравнение драйверов GAL4 для активности во время оогенеза. (A) Скорость откладки яиц самками, в которых указанный драйвер GAL4 присутствовал в комбинации с трансгенами для KD osk или bru1 .(B) Шаблоны экспрессии из комбинации UAS-GFP и указанного драйвера GAL4. Каждая панель показывает одну овариолу от гермария (слева) до стадии 8 (справа). Панель (B ’) — это тот же набор панелей с увеличенным усилением в зеленом канале RGB. Масштабная линейка 100 мкм.

    Рисунок 2

    Сравнение драйверов GAL4 для активности во время оогенеза. (A) Скорость откладки яиц самками, в которых указанный драйвер GAL4 присутствовал в комбинации с трансгенами для KD osk или bru1 .(B) Шаблоны экспрессии из комбинации UAS-GFP и указанного драйвера GAL4. Каждая панель показывает одну овариолу от гермария (слева) до стадии 8 (справа). Панель (B ’) — это тот же набор панелей с увеличенным усилением в зеленом канале RGB. Масштабная линейка 100 мкм.

    Три из протестированных драйверов, NGV , MAT и 34C10 , существенно снизили кладку яиц в моделях osk KD; каждый должен быть активен на стадии или до нее, когда активность или нкРНК необходима для прохождения через оогенез.При использовании для bru1 KD каждый из этих драйверов также был эффективен в отношении остановки оогенеза. Один драйвер, NGT , вызывал остановку оогенеза у bru1 KD, но не мешал прохождению через оогенез у или KD. Хотя KD osk и bru1 сходны в том, что вызывают остановку оогенеза, природа ареста совершенно различна. В то время как osk KD допускает прогрессирование через ранние стадии, арест bru1 KD связан с избыточной пролиферацией половых клеток в псевдо-яичных камерах (дополнительный рисунок S1), что наблюдается у мутантов, лишенных активности bru1 (Parisi et ​​al. . 2001).

    Каждый из этих драйверов использовался в комбинации с трансгеном UAS-GFP для сравнения периодов активности во время оогенеза. Для всех генотипов использовались одинаковые настройки визуализации. Чтобы обнаружить более низкие уровни активности, исходные изображения (рис. 2B) были настроены идентично в зеленом (GFP) канале для повышения чувствительности (рис. 2B ’). Только те факторы, которые оказывают существенное влияние на кладку яиц в osk KD, были сильно активны в отношении экспрессии UAS-GFP на средних стадиях оогенеза.

    И драйверы MAT, и драйверы 34C10 производили GFP на значительном уровне от этапа 3, по крайней мере, до этапа 8 (конечная точка этого анализа). В принципе, постоянное появление GFP может возникать в результате начальной фазы экспрессии и сохранения белка на более позднем этапе развития или в результате постоянной экспрессии. Два наблюдения предполагают, что персистенция белка GFP не внесла существенного вклада в наблюдаемые закономерности. Во-первых, период полужизни GFP оказался коротким по сравнению со временем, необходимым для прохождения через оогенез: GFP, продуцируемый драйвером NGT в гермарии, не сохранялся (фигура 2B ’).Во-вторых, интенсивность сигнала GFP от драйверов MAT и 34C10 оставалась высокой и даже увеличивалась на этапах 3–8 (рис. 2, B и B ‘), несмотря на более чем 10-кратное увеличение объема яйца. камеры в тот период развития (King 1970). Если бы был только короткий период экспрессии, полученный GFP должен был бы постепенно становиться более разбавленным по мере увеличения объема.

    Последствия удаления

    или активности нкРНК на ранних стадиях оогенеза

    Драйвер NGT был активен только на очень ранней стадии оогенеза: экспрессия репортера UAS-GFP была обнаружена в гермарии и в камерах яйца стадии 2, в профиле развития, примерно дополняющем активность MAT (Рисунки 2B ‘). и 3А).Несмотря на раннюю активность NGT, не было никакого эффекта на кладку яиц у osk KD (Рисунок 2A). Таким образом, либо NGT не эффективен для osk KD, либо мРНК osk не требуется на ранних стадиях для прохождения через оогенез. Чтобы оценить эффективность NGT KD osk , мы контролировали уровни мРНК osk с помощью гибридизации in situ . В гермарии, включая камеры яйца стадии 1, еще не отпочковавшиеся, или мРНК были в значительной степени элиминированы (Рисунок 3, B и C).К стадии 4 уровни мРНК osk начали восстанавливаться: значительная часть яичных камер все еще содержала очень мало мРНК osk , в то время как другие имели уровни, приближающиеся к уровню w 1118 контроля. Напротив, osk KD с MAT вызвали лишь умеренное снижение мРНК osk в гермарии, в то время как яичные камеры стадии 4 были существенно истощены (рис. 3, B и C). Мы пришли к выводу, что активность или нкРНК не требуется на самых ранних стадиях оогенеза для прогрессирования через оогенез. Более того, результаты с драйвером NGT еще больше сужают определение критической фазы для требования активности или нкРНК в прогрессии через оогенез. Поскольку значительная часть яичных камер стадии 4 в osk KD с NGT все еще имеет чрезвычайно низкие уровни мРНК osk , но при этом не происходит снижения яйценоскости, активность osk ncRNA может потребоваться только позже. Мы пришли к выводу, что в какой-то момент между стадией 5 и временем ареста на стадии 6/7 мРНК osk выполняет функцию, которая делает возможным дальнейшее продвижение через оогенез.

    Рисунок 3

    мРНК osk может быть удалена с помощью KD на ранних этапах оогенеза. (A) MAT и NGT управляют активностью в раннем оогенезе. Показаны самые передние части яичников с гермарием слева и отдельными яйцевыми камерами справа. Масштабная линейка 10 мкм. На панелях справа отображается только зеленый канал RGB. (B) In situ обнаружение мРНК osk на ранних стадиях оогенеза. Для обеих стадий сигнал мРНК osk из левого столбца показан сам по себе в правом столбце.Для стадии 4 уровни мРНК osk в KD с драйвером NGT были переменными, и показаны два примера, указывающих на эту вариацию. Шкала 10 мкм. (C) Количественное определение уровней мРНК osk на ранних стадиях оогенеза из изображений гибридизации in situ (репрезентативные примеры на панели B). Для этапа 4 анализа были выбраны условия визуализации, чтобы лучше всего выявить различия в низких уровнях мРНК osk в мутанте osk и KD; следовательно, для образца дикого типа наблюдалось насыщение сигнала (интенсивность пикселей 255). P -значения были получены из критерия суммы рангов Вилкоксона. Для всех парных сравнений P <0,01, за двумя исключениями: в образцах гермария / стадии 1 P <0,1 для w 1118 vs MAT≫osk-shRNA # 3 и для osk 0 против NGT≫osk-shRNA # 3 .

    Рисунок 3

    мРНК osk может быть удалена с помощью KD на ранних этапах оогенеза. (A) MAT и NGT управляют активностью в раннем оогенезе.Показаны самые передние части яичников с гермарием слева и отдельными яйцевыми камерами справа. Масштабная линейка 10 мкм. На панелях справа отображается только зеленый канал RGB. (B) In situ обнаружение мРНК osk на ранних стадиях оогенеза. Для обеих стадий сигнал мРНК osk из левого столбца показан сам по себе в правом столбце. Для стадии 4 уровни мРНК osk в KD с драйвером NGT были переменными, и показаны два примера, указывающих на эту вариацию.Шкала 10 мкм. (C) Количественное определение уровней мРНК osk на ранних стадиях оогенеза из изображений гибридизации in situ (репрезентативные примеры на панели B). Для этапа 4 анализа были выбраны условия визуализации, чтобы лучше всего выявить различия в низких уровнях мРНК osk в мутанте osk и KD; следовательно, для образца дикого типа наблюдалось насыщение сигнала (интенсивность пикселей 255). P -значения были получены из критерия суммы рангов Вилкоксона.Для всех парных сравнений P <0,01, за двумя исключениями: в образцах гермария / стадии 1 P <0,1 для w 1118 vs MAT≫osk-shRNA # 3 и для osk 0 против NGT≫osk-shRNA # 3 .

    Остановка оогенеза — лишь одно из проявлений отсутствия или мРНК. Другие или нулевые фенотипы РНК, такие как измененная организация MTOC (Kenny et ​​al. 2021) и дефектное формирование кариосомы (Jenny et ​​al. 2006; Канке и др. 2015), может явиться до момента задержания. Ожидается, что эти процессы будут чувствительны к потере мРНК или на ранних этапах оогенеза от KD. Действительно, распределение мРНК osk , когда она присутствует в яичных камерах стадии 4 после osk KD с NGT (Рисунок 3B), предполагает дефект MTOC. В ооцитах дикого типа MTOC от стадий 2 до 6 расположен в задней части ооцита (Theurkauf et ​​al. 1992), и это распределение лежит в основе заднего обогащения множественных мРНК, включая саму или (Clegg et ​​al. . 1997). По сравнению с ооцитами стадии 4 дикого типа, в osk KD с NGT , заднее обогащение мРНК osk оказалось сниженным.

    Организация MTOC отслеживалась с использованием гамма-тубулина в качестве маркера, первоначально фокусируясь на камерах 3 и 4 яиц. Заднее обогащение теряется в отсутствие мРНК или с множественными очагами гамма-тубулина, присутствующими по всему ооциту (Kenny et ​​al. 2021) (рис. 4A). Похожий дефект был обнаружен в начале osk KD с драйвером NGT (рис. 4, A и B).

    Рисунок 4

    Нарушение MTOC из KD osk в раннем оогенезе. (A) Типичная стадия 3-4 яичных камер от самок с указанными генотипами. Каждая яйцеклетка ориентирована кзади, положение ооцита — вправо. Левая колонка: полные камеры яйца, окрашенные на гамма-тубулин (зеленый) и ДНК (красный). Масштабная линейка 10 мкм. Средний столбец: изображения из левого столбца только с сигналом гамма-тубулина (белый). Правый столбец: увеличение участков, выделенных желтым цветом в среднем столбце, содержащих ооцит.(B) Измерения площадей, ограниченных очагами гамма-тубулина в ооците (см. Материалы и методы). Для каждого генотипа было проанализировано не менее 19 ооцитов. Значения P были получены с помощью критерия суммы рангов Вилкоксона: *** P <0,01. (C) Репрезентативная стадия 5–6 яичных камер от самок с указанными генотипами. Каждая камера для яиц ориентирована кзади вправо. Слева: полные камеры яйца, окрашенные на гамма-тубулин (зеленый) и ДНК (красный). Масштабная линейка 10 мкм.Задний участок с ооцитом показан справа только с сигналом гамма-тубулина (белый).

    Рисунок 4

    Нарушение MTOC из KD osk в раннем оогенезе. (A) Типичная стадия 3-4 яичных камер от самок с указанными генотипами. Каждая яйцеклетка ориентирована кзади, положение ооцита — вправо. Левая колонка: полные камеры яйца, окрашенные на гамма-тубулин (зеленый) и ДНК (красный). Масштабная линейка 10 мкм. Средний столбец: изображения из левого столбца только с сигналом гамма-тубулина (белый).Правый столбец: увеличение участков, выделенных желтым цветом в среднем столбце, содержащих ооцит. (B) Измерения площадей, ограниченных очагами гамма-тубулина в ооците (см. Материалы и методы). Для каждого генотипа было проанализировано не менее 19 ооцитов. Значения P были получены с помощью критерия суммы рангов Вилкоксона: *** P <0,01. (C) Репрезентативная стадия 5–6 яичных камер от самок с указанными генотипами. Каждая камера для яиц ориентирована кзади вправо.Слева: полные камеры яйца, окрашенные на гамма-тубулин (зеленый) и ДНК (красный). Масштабная линейка 10 мкм. Задний участок с ооцитом показан справа только с сигналом гамма-тубулина (белый).

    Потеря или мРНК из NGT KD не сохранялась по мере развития оогенеза. Следовательно, мы могли бы спросить, восстановилась ли организация MTOC, поскольку или мРНК вновь появились из продолжающейся транскрипции. В яичных камерах стадии 5 и 6 дикого типа скопления гамма-тубулина переходили в один или два преобладающих очага (рис. 4C).В отсутствие мРНК или аномальное распределение гамма-тубулина сохранялось на более поздних стадиях оогенеза (рис. 4С). Напротив, в начале osk KD с драйвером NGT нормальный паттерн был восстановлен без значительных отличий от дикого типа на стадиях 5/6.

    Мы также наблюдали за формированием кариосом на тех же ранних и средних стадиях оогенеза. На 2 стадии оогенеза хромосомы появляются по всему ядру ооцита. По завершении мейотической рекомбинации хромосомы ооцитов конденсируются, образуя кариосому, единый компактный кластер внутри ядра (King 1970) (Рисунок 5).Формирование кариосом является дефектным при отсутствии активности нкРНК или , при этом хромосомы разделены на два или более фокусов (Jenny et ​​al. 2006; Kanke et ​​al. 2015) (Рисунок 5). KD мРНК osk с драйвером NGT вызывал такой же дефект (фиг. 5A), статистически неотличимый от мутанта osk 0 (фиг. 5C).

    Рисунок 5

    Нарушение образования кариосом из KD osk в раннем оогенезе.(A) Репрезентативные стадии 3-4 камеры яйца от самок с указанными генотипами. Каждая камера для яиц ориентирована кзади вправо. Слева: полные камеры яйца, окрашенные на ДНК (красный) и ламин (зеленый), чтобы очертить ядра. Масштабная линейка 10 мкм. Справа: увеличение ядер ооцитов на изображениях слева. (B) Репрезентативная стадия 5–6 яичных камер от самок с указанными генотипами. Представлено как на панели A, за исключением того, что масштабная линейка составляет 20 мкм. (C) Доля ооцитов 3-4 стадии указанных генотипов с нормальными кариосомами, определяемая как единый кластер ДНК в ядре ооцита.Указывается количество (n) ооцитов, проанализированных для каждого генотипа. Значения P были получены с помощью критерия суммы рангов Вилкоксона: *** P <0,01. (D) Доля ооцитов 5-6 стадии указанных генотипов с нормальными кариосомами, определяемая как единый кластер ДНК в ядре ооцита. Значения P были получены с помощью критерия суммы рангов Вилкоксона: *** P <0,01.

    Рисунок 5

    Нарушение образования кариосом из KD osk в раннем оогенезе.(A) Репрезентативные стадии 3-4 камеры яйца от самок с указанными генотипами. Каждая камера для яиц ориентирована кзади вправо. Слева: полные камеры яйца, окрашенные на ДНК (красный) и ламин (зеленый), чтобы очертить ядра. Масштабная линейка 10 мкм. Справа: увеличение ядер ооцитов на изображениях слева. (B) Репрезентативная стадия 5–6 яичных камер от самок с указанными генотипами. Представлено как на панели A, за исключением того, что масштабная линейка составляет 20 мкм. (C) Доля ооцитов 3-4 стадии указанных генотипов с нормальными кариосомами, определяемая как единый кластер ДНК в ядре ооцита.Указывается количество (n) ооцитов, проанализированных для каждого генотипа. Значения P были получены с помощью критерия суммы рангов Вилкоксона: *** P <0,01. (D) Доля ооцитов 5-6 стадии указанных генотипов с нормальными кариосомами, определяемая как единый кластер ДНК в ядре ооцита. Значения P были получены с помощью критерия суммы рангов Вилкоксона: *** P <0,01.

    Дефекты кариосом из ранних osk KD с драйвером NGT были существенно исправлены по мере продолжения оогенеза, и уровни мРНК osk увеличились, хотя значительная часть яичных камер все еще имела аномальные кариосомы на стадиях 5/6 (Рисунок 5, B и D; пример, показанный на рисунке 5B, — это тот, в котором кариосома остается ненормальной).

    Поскольку начальная неспособность сформировать кариосому или правильно расположить MTOC не помешала хотя бы частичному восстановлению, когда уровни мРНК osk начали восстанавливаться, критический период для активности osk ncRNA в этих двух процессах продолжается, и Роль мРНК osk должна встречаться многократно, а не только один раз. Различная степень исправления этих дефектов может отражать разные способы действия или нкРНК в каждом процессе или различную чувствительность к потере или мРНК. При любом объяснении кажется маловероятным, что мРНК osk выполняет единичное начальное событие, которое затем участвует в различных путях.

    Доступность данных

    Данные, лежащие в основе этой статьи, доступны в статье и в дополнительных материалах к ней.

    Дополнительные материалы доступны по адресу G3 в Интернете.

    Благодарности

    Авторы благодарят Клэр Янхуи Ху за дизайн shРНК и Аллана Спредлинга за штаммы мух.Аллан Спрэдлинг щедро поделился информацией о примерах драйверов Janelia Farm GAL4, которые активны в яичнике. В этом исследовании использовались поголовья мух, полученные из Центра содержания дрозофил Блумингтона (NIH P40OD018537). Антитела были получены из банка гибридом исследований развития, созданного NICHD Национального института здоровья и поддерживаемого на факультете биологии Университета Айовы, Айова-Сити, Айова 52242.

    Финансирование

    Финансирование было предоставлено грантом R01 GM118526 Национального института здравоохранения.

    Конфликт интересов

    Авторы заявляют об отсутствии конфликта интересов.

    Цитированная литература

    Аббасзаде

    EK

    ,

    Гавис

    ER.

    2016

    .

    Фиксированная и живая визуализация РНК в ооцитах и ​​эмбрионах дрозофилы

    .

    Методы

    .

    98

    :

    34

    41

    .

    Марка

    AH

    ,

    Perrimon

    N.

    1993

    .

    Нацеленная экспрессия генов как средство изменения судьбы клеток и создания доминантных фенотипов

    .

    Развитие

    .

    118

    :

    401

    415

    .

    Clegg

    NJ

    ,

    Frost

    DM

    ,

    Larkin

    MK

    ,

    Subrahmanyan

    L

    ,

    Bryant

    Z

    и др.

    1997

    .

    водоворот необходим для ранней стадии установления полярности ооцитов Drosophila : задняя локализация мРНК grk

    .

    Развитие

    .

    124

    :

    4661

    4671

    .

    Fenno

    L

    ,

    Yizhar

    O

    ,

    Deisseroth

    K.

    2011

    .

    Развитие и применение оптогенетики

    .

    Анну Рев Neurosci

    .

    34

    :

    389

    412

    .

    Gossen

    M

    ,

    Bujard

    H.

    1992

    .

    Жесткий контроль экспрессии генов в клетках млекопитающих с помощью промоторов, чувствительных к тетрациклину

    .

    Proc Natl Acad Sci USA

    .

    89

    :

    5547

    5551

    .

    Gossen

    M

    ,

    Freundlieb

    S

    ,

    Bender

    G

    ,

    Müller

    G

    ,

    Hillen

    W

    и др.

    1995

    .

    Активация транскрипции тетрациклинами в клетках млекопитающих

    .

    Наука

    .

    268

    :

    1766

    1769

    .

    Ярвик

    J

    ,

    Ботштайн

    D.

    1973

    .

    Генетический метод определения порядка событий в биологическом пути

    .

    Proc Natl Acad Sci USA

    .

    70

    :

    2046

    2050

    .

    Jenny

    A

    ,

    Hachet

    O

    ,

    Závorszky

    P

    ,

    Cyrklaff

    A

    ,

    Weston

    MDJ

    и др.

    2006

    .

    Независимая от трансляции роль РНК oskar в раннем оогенезе Drosophila

    .

    Развитие

    .

    133

    :

    2827

    2833

    .

    Канке

    M

    ,

    Jambor

    H

    ,

    Reich

    J

    ,

    Марки

    B

    ,

    Gstir

    R

    и др.

    2015

    .

    oskar РНК играет несколько некодирующих ролей, поддерживая оогенез и поддерживая целостность различия зародышевой линии / сомы

    .

    РНК

    .

    21

    :

    1096

    1109

    .

    Кенни

    A

    ,

    Морган

    МБ

    ,

    Макдональд

    PM.

    2021

    .

    Различные роли соседних и структурно подобных A-богатых и поли (A) доменов мРНК oskar : только A-богатый домен необходим для функции некодирующей РНК oskar, которая включает позиционирование MTOC

    .

    Дев Биол

    .

    476

    :

    117

    127

    .

    Kim-Ha

    J

    ,

    Smith

    JL

    ,

    Macdonald

    PM.

    1991

    .

    мРНК oskar локализована на заднем полюсе ооцита дрозофилы

    .

    Ячейка

    .

    66

    :

    23

    35

    .

    Kim-Ha

    J

    ,

    Kerr

    K

    ,

    Macdonald

    PM.

    1995

    .

    Регулирование трансляции мРНК oskar с помощью Bruno, белка, связывающего РНК яичников, имеет важное значение

    .

    Ячейка

    .

    81

    :

    403

    412

    .

    King

    RC.

    1970

    .

    Развитие яичников у Drosophila Melanogaster

    .

    Нью-Йорк, Нью-Йорк

    :

    Academic Press

    .

    Кумар

    D

    ,

    An

    CI

    ,

    Yokobayashi

    Y.

    2009

    .

    Условная интерференция РНК, опосредованная аллостерическим рибозимом

    .

    Дж. Ам Хем Соц

    .

    131

    :

    13906

    13907

    .

    Larkin

    A

    ,

    Marygold

    SJ

    ,

    Antonazzo

    G

    ,

    Attrill

    H

    ,

    Dos Santos

    G

    и др. ; Консорциум FlyBase.

    2021

    .

    FlyBase: обновления базы знаний Drosophila melanogaster

    .

    Nucleic Acids Res

    .

    49

    :

    D899

    D907

    .

    Лю

    N

    ,

    Ласко

    P.

    2015

    .

    Анализ интерференционных линий РНК позволяет идентифицировать новые функции материнских генов, участвующих в формировании эмбрионального паттерна у Drosophila melanogaster

    .

    G3 (Bethesda)

    .

    5

    :

    1025

    1034

    .

    Mohr

    S

    ,

    Kenny

    A

    ,

    Lam

    STY

    ,

    Morgan

    MB

    ,

    Smibert

    CA

    и др.

    2021

    .

    Противоположные роли Egalitar и Staufen в транспорте, закреплении и локализации мРНК oskar в ооците Drosophila

    .

    PLoS Genet

    .

    17

    :

    e1009500

    .

    Parisi

    MJ

    ,

    Deng

    W

    ,

    Wang

    Z

    ,

    Lin

    H.

    2001

    .

    Арест гена необходим для образования цист зародышевой линии во время оогенеза Drosophila

    .

    Бытие

    .

    29

    :

    196

    209

    .

    Reveal

    B

    ,

    Yan

    N

    ,

    Snee

    MJ

    ,

    Pai

    C-I

    ,

    Gim

    Y

    и др.

    2010

    .

    BRE опосредуют как репрессию, так и активацию трансляции мРНК oskar и действуют в транс

    .

    Dev Cell

    .

    18

    :

    496

    502

    .

    Ryu

    YH

    ,

    Macdonald

    PM.

    2015

    . Последовательности

    РНК, необходимые для некодирующей функции РНК oskar , также опосредуют регуляцию экспрессии белка Oskar с помощью фактора стабильности Bicoid

    .

    Дев Биол

    .

    407

    :

    211

    223

    .

    Theurkauf

    WE

    ,

    Smiley

    S

    ,

    Wong

    ML

    ,

    Alberts

    BM.

    1992

    .

    Реорганизация цитоскелета во время оогенеза Drosophila : влияние на спецификацию оси и межклеточный транспорт

    .

    Развитие

    .

    115

    :

    923

    936

    .

    Vazquez-Pianzola

    P

    ,

    Urlaub

    H

    ,

    Suter

    B.

    2011

    .

    Pabp связывается с 3’UTR osk и специфически способствует стабильности мРНК osk и накоплению ооцитов

    .

    Дев Биол

    .

    357

    :

    404

    418

    .

    Webster

    PJ

    ,

    Liang

    L

    ,

    Berg

    CA

    ,

    Lasko

    P

    ,

    Macdonald

    PM.

    1997

    .

    Трансляционный репрессор bruno играет несколько ролей в разработке и широко сохраняется

    .

    Genes Dev

    .

    11

    :

    2510

    2521

    .

    © Автор (ы) 2021. Опубликовано Oxford University Press от имени Американского генетического общества.

    Это статья в открытом доступе, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License (https://creativecommons.org/licenses/by/4.0/), которая разрешает неограниченное повторное использование, распространение и воспроизведение на любом носителе при условии, что оригинал работа правильно цитируется.

    Исследование эффективности, специфичности и эффективности лентивирусной библиотеки shРНК

    Введение

    Введение малых интерферирующих РНК (миРНК) в культивируемые клетки обеспечивает быстрое и эффективное средство подавления экспрессии генов и позволило миРНК быстро стать повсеместным инструментом в молекулярной биологии.Хотя было показано, что миРНК эффективна для кратковременного ингибирования генов в некоторых трансформированных линиях клеток млекопитающих, существует явная проблема ее использования в первичных культурах клеток или для стабильного нокдауна транскрипта. Недавно библиотеки shRNA в лентивирусных векторах были описаны и использованы для модуляции экспрессии генов в эмбриональных стволовых клетках человека (Zaehres, et al., Stem Cells , 2005), а также у трансгенных мышей (Ventura et al., PNAS , 2004). Мы протестировали лентивирусную библиотеку shRNA (The TRC Library) на ее способность преодолевать ограничения siRNA.Мы трансдуцировали первичную культуру астроцитов человека с помощью 16 вирусов, нацеленных на четыре различных гена, каждый из которых, как было ранее продемонстрировано, важен для функции астроцитов (p38a, p38d, MAP3K4 и JNK2). Во всех 16 случаях нам удалось стабильное инфицирование клеток и нокдаун целевого гена. Уровни ингибирования гена варьировались от 40% до 99% по сравнению с контрольной вирусной инфекцией. Затем мы исследовали специфичность нокдауна каждой изоформы AKT (AKT1, AKT2 и AKT3). Мы обнаружили для каждого гена shРНК, которые ингибируют одну изоформу-мишень, сохраняя при этом две другие изоформы. Наконец, мы протестировали панель клеточных линий, чтобы определить диапазон инфекционности этого вируса. В дополнение к первичной культуре астроцитов, вирус оказался эффективным в подавлении экспрессии генов в опухолевых клетках A549 (легкое человека), Panc1 (поджелудочная железа человека), HCT116 (толстая кишка человека) и HepG2 (печень человека). Это исследование демонстрирует, что кшРНК в лентивирусном векторе могут быть эффективным средством ингибирования РНК в широком спектре клеток, позволяя специфические и эффективные изменения генов и преодолевая общие ограничения миРНК.

    Обзор

    Молчание и нокдаун генов с использованием РНК-интерференции становится обычным делом. Конструкции короткой шпильки в некоторых случаях имеют преимущества перед siRNA, поскольку эффекты этих конструкций могут привести к более стабильному и долгосрочному результату. Конструкции лентивируса кшРНК MISSION ™ TRC обладают еще одним преимуществом, поскольку их можно использовать для легкой трансдукции типично сложных клеточных линий, таких как первичные астроциты, а также неделящихся клеток. Эту библиотеку коротких шпилечных конструкций можно использовать в широком спектре исследований, включая анализ отдельных генов, выяснение путей или даже функциональный скрининг в масштабе всего генома.

    Мы исследовали вариабельный нокдаун, возникающий после инфицирования линии клеток опухоли легкого человека A549 четырьмя клонами, предназначенными для нацеливания на JAK1. Затем клон, обеспечивающий лучший нокдаун, был выбран для дальнейшего исследования на четырех других линиях клеток человека.

    Специфичность ингибирования shРНК мишени также очень важна. Предыдущие исследования с использованием миРНК показали значительные нецелевые эффекты (Jackson, et al., Nat Biotechnol 2003). Линия клеток опухоли легкого человека A549 экспрессирует все три известные изоформы AKT (AKT1, AKT2 и AKT3).Считается, что ингибирование каждой отдельной изоформы приводит к фенотипическим различиям. Были исследованы конструкции, разработанные для всех трех изоформ, и проанализировано результирующее влияние на оставшиеся две изоформы.

    Результаты

    Были затронуты четыре разных гена. Минимально четыре различных конструкции shRNA были исследованы для каждого гена. Выбранные гены представляли гены, идентифицированные как релевантные для нормальных клеточных путей астроцитов: JNK2, p38a, p38d и MAP3K4 (Hasselblatt, et al., Нейрорепорт 2006; Yoo et al., Arch Pharm Res 2005). Препараты вируса, содержащие shРНК, успешно трансдуцировали 100% первичных обработанных культур астроцитов. После отбора с помощью пуромицина наблюдались различные уровни нокдауна (, фиг. 1, ).

    .

    Добавить комментарий

    Ваш адрес email не будет опубликован.