Содержание

медовые соты — калорийность, пищевая ценность ⋙ TablicaKalorijnosti.ru

Состояние

не приготовлено с термической обработкой

Белки

{{foodstuff.foodstuff.protein}} г

Углеводы

{{foodstuff.foodstuff.carbohydrate}} г

Сахар

{{foodstuff.foodstuff.sugar}} г-

Жиры

{{foodstuff.foodstuff.fat}} г

Насыщенные жирные кислоты

{{foodstuff.foodstuff.saturatedFattyAcid}} г-

Транс-жирные кислоты

{{foodstuff. foodstuff.transFattyAcid}} г-

Моно-ненасыщенные

{{foodstuff.foodstuff.monoSaturated}} г-

Полиненасыщенные

{{foodstuff.foodstuff.polySaturated}} г-

Холестерин

{{foodstuff.foodstuff.cholesterol}} мг-

Волокна

{{foodstuff.foodstuff.fiber}} г

Соль

{{foodstuff.foodstuff.salt}} г-

Вода

{{foodstuff.foodstuff.water}} г-

Кальций

{{foodstuff.foodstuff.calcium}} мг-

GI Гликемический индексhelp

{{foodstuff. foodstuff.gi}}

PHE

{{foodstuff.foodstuff.phe}} мг-

Aлкоголь

{{foodstuff.foodstuff.alcohol}} г

сколько ккал содержится в одной чайной ложке?

Мед — натуральное, вкусное и полезное лакомство, которое можно употреблять как отдельный продукт, так и добавляя в блюда по желанию. Однако вместе с пользой, мед таит в себе и опасность. Во-первых, мед – сильный аллерген. Детям до года его давать не желательно. Во-вторых, диабетикам также лучше воздержаться от употребления данного лакомства.

В данной статье мы рассмотрим мед в разных аспектах. Узнаем его калорийность, разберем можно ли употреблять его диабетикам и с какого возраста можно давать детям.

Калорийность меда: сколько ккал содержится в одной чайной ложке?

Вкус всегда сопровождается питательностью, поэтому мед — высококалорийный продукт, встречающийся на наших столах. Но это не причина отказываться от него во время диеты. Необходимо с рациональностью, не переедая, употреблять его.

Вид мёдаккал на 100 грамм
Цветочный303
Акациевый335
Гречишный301
Вересковый309
Медовые соты327
Липовый323
Мед с орехами485

Как видно из таблицы, каждый вид продукта пчеловодства имеет свою калорийность. Но 100 грамм понятие не очень понятное. Куда понятней считать мед ложками. Так сколько же калорий в 1 чайной и столовой ложке меда:

  • В 1 чайной ложке с горкой — 32 Ккал
  • В 1 столовой ложке с горкой — 72 Ккал

Липовый мед — продукт, состоящий из максимума полезных веществ, что делает его самым вкусным и востребованным, в сравнении с другими сортами. В 100 граммах лакомства содержится около 320 Ккал.

Гречишный мед пчелы собирают из нектара цветущей гречихи

. Оттенок у него яркий, от жёлтого до коричневого, а иногда красноватого. Данный продукт относят к высококачественным, имеющим приятный аромат. Имеет в составе 37% глюкозы и 40% фруктозы, что способствует его высокой калорийности – на 100 г 301 ккал.

Издавна люди задаются вопросом: есть ли в составе меда сахар? Да, но не такой, как в магазине, а плодовый и виноградный, в виде фруктозы с глюкозой, при этом хорошо усвояемый организмом.

В сложном составе природного меда главное место занимают углеводы, количество которых составляет около 86%. В зависимости от сорта, углеводы могут более 40 видов.

Главные из них – это глюкоза и фруктоза. Их количество составляет до 90% от веса всех углеводов. Остальные – сложные олигосахариды, дисахариды и сахароза. Ее в составе продукта пчеловодства находится около 3%.

Что содержит больше калорий: сахар или мед?

Многие люди задаются вопросом, калориен ли мед.

Давайте разбирать. Сахарный песок содержит больше калорий, чем мед. К примеру, в чайной ложке сахара — до 18 калорий, а в меде — 27 калорий.

В этом случае калорийность медового лакомства выше, но не из-за того, что сахара меньшая калорийность, а потому, что у меда плотность выше, и в ложку его помещается немного больше, нежели сахарного песка. В 100 граммах сахара — 400 Ккал, в меде около 330 Ккал.

Идеальных продуктов не существует, так и мед не рекомендован к употреблению людям с тяжелыми формами диабета, страдающим аллергией и ожирением.

Несмотря на свою полезность, медовый продукт достаточно калориен, а сахар менее полезен, и имеет большую калорийность. При этом медовые калории намного быстрее усвоятся, а употребление сахара способствует быстрому утомлению, возникновению кариеса и сонливости.

Свежий натуральный мед с сотами

Можно ли употреблять при сахарном диабете: польза и вред

Можно ли есть мед при сахарном диабете? В этом вопросе существует много разных мнений.

Одни считают, что мед для диабетиков полезен — понижает сахар в крови, а остальные утверждают, что медовый продукт повышает его.

Исследования доказывают, что употребление меда при диабете не всегда допустимо.

При сахарном диабете требуется строгое соблюдение диеты, и при ее несоблюдении нет разницы, чем травить себя — сахаром или медом в больших дозах. Но при повышенном уровне сахара в крови — мед противопоказан.

Мнение о том, что мед и диабет несовместимы — ошибочно. Медовый продукт при этом заболевании допустим, следует только употреблять определенное количество лакомства и подобрать вид, полезный при данной болезни.

Специалисты утверждают, что употребление медового лакомства при диабете 1-го типа не только можно, но и необходимо. Многократными экспериментами доказано, что постоянное потребление данного лакомства способствует снижению давления и нормализации уровня гликогемоглобина на 2%.

Благодаря своему составу, мед очень медленно всасывается, что способствует стабилизации глюкозы в крови. Поэтому, на вопрос: можно ли есть мед при сахарном диабете 2 типа будет также положительным. Главное соблюдать строгую ежедневную дозировку – 1 ст.л. в день. При больших количествах могут начаться серьезные проблемы.

Засахаривание

А теперь разберем, должен ли мед засахариваться и почему это происходит. Кристаллизация меда – природный процесс, если только он натуральный и без каких-либо добавок. На его характер влияют определенные факторы, выявляющие скорость и особенности этого процесса.

При температуре 35°C, мед начинает постепенно таять.

Когда идет превышение 40-50°C, большинство полезных веществ разрушаются, и пчелиный продукт становится обыкновенным сладким сиропом. Поэтому если мед сахарится – это считается нормой.

Глюкоза и фруктоза – основные составляющие меда. Благодаря этим элементам, мед засахаривается. Глюкоза твердеет, а фруктоза не меняет жидкого состояния, обволакивая глюкозу. При зачерпывании закристаллизованного меда из банки, можно увидеть небольшое количество жидкого меда.

Кристаллизация — это естественное свойство меда. Натуральный мед обязательно должен засахариваться, по истечению двух месяцев после скачки. Исключением является лишь первичный медовый продукт, который может храниться жидким более 2-х лет.

Какой домашний мед не засахаривается и почему?

Коэффициент фруктозы и глюкозы — основной показатель, дающий оценку силе засахаривания меда. Лакомство с повышенным количеством фруктозы засахаривается неспешно и легко размягчается.

Засахаривание разного вида меда

Кристаллы глюкозы собираются на дне, а наверх поднимается темная масса. Яркий пример этому, мед с акации, с преобладанием фруктозы – он может засахариться, но при этом почти не затвердевает, оставаясь в жидком состоянии. Пример такого меда – подсолнечный, с преобладанием глюкозы, который может  кристаллизоваться в быстрый срок.

Вес меда меняет свои показатели в зависимости от температуры и влажности в нем. Чем выше эти данные, тем меньше вес.

Вас также могут заинтересовать следующие статьи на тему меда:

  • Как правильно принимать мед с водой по утрам?
  • Полезные свойства и противопоказания клеверного меда.
  • Полезные свойства дикого меда.

Сколько килограмм/грамм помещается в литровую/трехлитровую банку?

Для замера пользуются граммами и килограммами. Плотность медового лакомства составляет ориентировочно 1,5 кг на 1,5 литра. При повышенной влажности плотность уменьшается.

  • в 1 чайной ложке без горки — 8 грамм меда;
  • в 1 столовой ложке без горки – 17 грамм;
  • 50 г меда — это 2,9 столовых ложек или 4,2 чайных ложек без горки. С горкой — 1,5 столовых или 2,5 чайных ложек.

Главный принцип соотношения веса и количества пчелиного нектара составляет 1. 4/1, к примеру:

  • в литровой банке помещется 1,4 кг меда;
  • в трехлитровой банке получается чуть больше 4 кг меда.

И в обратном порядке:

  • 1 кг меда вмещается в тару 750 мл;
  • 500 г меда вмещается в тару 450 мл;
  • 100 г — около пяти столовых ложек меда без горки.

Сколько можно есть пчелиного продукта в день взрослому человеку и грудному ребенку?

А теперь поговорим о том, сколько меда можно съесть в день без вреда для человека. Мед — полезный продукт для человеческого организма.

Взрослому рекомендуется в сутки употреблять по 100-150 г продукта. Для лучшего усваивания, его необходимо съедать за 1,5-2 часа до приема пищи, либо по истечению 3 часов после еды. Лучший способ употребления — с теплым молоком, чаем или водой.

Суточная доза употребления меда для взрослого человека в день.

Для детей потребление меда рекомендуется вместе с другой едой — с чаем, фруктами или кашей. Таким способом организм быстрее усваивает лакомство. Давать малышам большое количество продукта не следует, иначе у них может появится отвращение.

Мед относят к высокоаллергенным продуктам, и, перед тем, как дать его ребенку, нужно помнить об этом и не злоупотреблять. Специалисты рекомендуют знакомить малышей с медом после трех лет, не более 1–2 чайных ложек в сутки. Грудным детям лакомство лучше не давать.

Когда такое знакомство уже было, и не произошло аллергических реакций, то ребенку до двух лет можно предлагать по 0,5 чайной ложки, а старше двух лет не больше 1 чайной ложки в сутки. У детей, склонных к аллергии, из рациона мед исключается.

Химический состав и таблица содержания компонентов

В таблице показан химический состав и содержание всех компонентов продукта пчеловодства (витамины, минералы, калорийность, белки, жиры и углеводы) на 100 грамм продукта.

Минералы
Калий64мг
Фосфор7,2мг
Кальций5,1мг
Марганец0,36мг
Медь31мг
Цинк0,1мг
Магний2,9мг
Железо0,5мг
Хром
5
мг
Бор0,7мг
Фтор8мг
Витамины
Витамин А0,04мг
Витамин B20,04мг
Витамин В30,3мг
Витамин В50,07мг
Витамин В50,8мг
Витамин В60,02мг
Витамин В90,08мг
Витамин С2мг
Витамин Е4мг
Витамин H0,15мг
Витамин K1мг

Химический состав центробежного меда (по Дж. У. Уайту)

Состав%г
Вода (естественная влажность)17,2078,0
Сахара:

Левулеза (фруктовый сахар)

Декстроза (виноградный сахар)

Сахароза (столовый сахар)

Мальтоза и другие дисахариды

Высшие сахара

38,19

31,28

1,31

7,31

1,50

173,2

141,9

5,9

33,2

6,8

Всего сахаров79,59361,0
Кислоты (гликоновая, лимонная, яблочная, муравьиная, уксусная, масляная, молочная и т, д.)0,572,6
Белки0,261,2
Зола (калий, натрий, кальций, магний, хлориды, сульфаты, фосфаты и др.)0,170,8
Всего кислоты, белков и золы1,004,6
Второстепенные компоненты (пигменты, ферменты, витамины, спирты, вкусовые и ароматические вещества)2,2110,0
Итого100453,6

 

ГОСТ на медовую продукцию

ГОСТ Р 54644 2011 на пчелиное лакомство последней разработки «Мед натуральный. Технические условия» действует ещё с 01.01.2013 года, но большинство организации, маркируя товар, ставят ГОСТ 19792-2001. Здесь никакой ошибки нет — ГОСТ 19792-2001 действителен до 01.01.2017 г.

По ГОСТу Р 54644-2011 разделяют на:

  • падевый — собранный насекомыми из лиственных или хвойных насаждений;
  • цветочный — собранный насекомыми из цветов-медоносов;
  • смешанный — природное объединение эти двух видов.

По способу сбора, продукт классифицируется на:

  • прессовый — добыт путем прессования сот;
  • центрифугированный — добыт из сот с помощью центрифугирования;
  • мед в сотах — кусочек или несколько кусочков сот, помещенные в емкость и заливается центробежным медовым лакомством.

К продаже разрешен только вышеперечисленные виды медового продукта с такими данными:

  • должен быть жидким, полностью или частично засахаренным;
  • без сторонних ароматов, с собственным приятным запахов;
  • быть сладким, без лишнего привкуса.
Мед, разлитый по банкам и готовый к продаже или хранению

Как, где и в чем хранить настоящий натуральный продукт?

Как правильно хранить мед в домашних условиях  в квартире? Хранить мед следует в герметически закрытой емкости в сухом, хорошо проветриваемом месте. Это необходимо из-за того, что мед относится к категории гигроскопичной продукции. Продукт поглощает влажность около 50% от своего веса. Помещение, где остается мед не должно иметь каких-либо ароматов.

Место в квартире для сохранения медового лакомства должно быть без попадания солнечных лучей, хорошо проветриваемым и прохладным. Рождается логичный вопрос: можно ли ставить мед в холодильник, ведь все критерии соответствуют? Да, можно – это подходящий способ, особенно летом. При этом тара должна плотно закрываться, чтобы мед не впитывал в себя запахи и влажность.  Лучше хранить в стеклянной посуде с герметичной крышкой.

В чем лучше хранить мед? Наиболее подходящими емкостями для хранения считаются:

  • алюминиевые бидоны;
  • деревянные бочонки;
  • глиняная и керамическая емкость;
  • стеклянная посуда;
  • жестяная тара, внутри покрытая пищевой краской4
  • картонные стаканы или бумажные пакеты, обработанные парафином;

Вся посуда обязательно должна герметично закрываться, при использовании стеклянной тары, лучше подобрать ее с темным стеклом.

Качества, которыми обладает мед в сотах, дают возможность хранить его в естественном виде длительное время. Медовый продукт в данном варианте всегда обеззараженный, а находящиеся в воске секреты слюны насекомых не дают бактериям попасть в мед. Но существует один минус: воск пропускает влагу, что вызывает брожение.

Сколько именно можно хранить настоящий мед дома? Медовое лакомство долго сохраняет свои полезные свойства, при этом, это уникальный продукт, который хранится в сыром виде. К примеру, известный историк Т.М. Дэвис нашел емкость с медом в одном из захоронений в Египте, которой было 3300 лет. К его удивлению, мед был в отличном состоянии.

Чем полезен мед в сотах, как употреблять, можно ли есть соты? | VSESVOE.online

Чем полезен мед в сотах, как употреблять, можно ли есть соты

Мед в сотах считается наиболее ценным для здоровья. Чтобы понять, действительно ли свойства меда в сотах так полезны, нужно изучить особенности продукта.

Что такое сотовый мед

Подробно о том, как пчелы делают мед, мы рассказывали ранее. Пчелы, собирающие мед, обитают в ульях, состоящих из множества небольших ячеек -шестигранников. Эти ячейки называют сотами, между собой они разделены восковыми стенками, а внутри сот хранится натуральный мед в жидком или кристаллизованном виде.

Мед в сотах особенно полезен, поскольку в нем присутствуют ценнейшие для здоровья вещества — прополис, цветочная пыльца, перга. В обработанном продукте такие компоненты отсутствуют, что по определению делает его свойства менее полезными.

Состав и калорийность меда в сотах

Сотовый мед содержит более 300 натуральных полезных компонентов. Среди основных можно перечислить:

  • витамины В и С;
  • альбуминоиды и фитонциды;
  • энзимы;
  • глюкозу и фруктозу;
  • широкий ряд органических кислот;
  • белки;
  • фолиевую и пантотеновую кислоты;
  • аминокислоты;
  • эфирные соединения;
  • алюминий и хлор, серу и марганец и др.

Польза и вред медовых сот, как и их детальный состав, могут отличаться в зависимости от местности, где был собран продукт. Калорийность продукта составляет около 327 ккал на 100 г.

Польза сотового меда

Польза пчелиных сот распространяется практически на все внутренние органы и системы. При регулярном употреблении в пищу продукт способен:

  • облегчать симптомы простуды и способствовать скорейшему выздоровлению;
  • очищать сосуды и печень, препятствовать развитию атеросклероза;
  • улучшать состояние желудка и кишечника, регулировать скорость обменных процессов;
  • повышать уровень гемоглобина в крови и тем самым препятствовать появлению анемии;
  • исцелять кашель, бронхит и другие заболевания дыхательной системы;
  • регулировать артериальное давление и облегчать состояние при тромбофлебите и варикозе;
  • препятствовать развитию кариеса и других заболеваний полости рта;
  • защищать глаза от воспалительных недугов и снижения остроты зрения.

Для взрослых женщин и мужчин

Польза меда в сотах для мужчин состоит, прежде всего, в том, что продукт хорошо влияет на состояние сосудов и сердца. Мужчины в зрелом возрасте намного чаще страдают от ишемии, особенно склонны к инфарктам и инсультам. Регулярное употребление меда позволяет снизить риски развития опасных заболеваний.

Мед в сотах является сильным природным афродизиаком. Его применение в пищу благотворно сказывается на половых функциях — продукт не только улучшает потенцию, но и повышает качество генетического материала. Соответственно, от него будет большая польза при планировании зачатия.

Польза меда в сотах для женщин также затрагивает репродуктивную сферу. Продукт помогает наладить гормональный фон и защищает от сбоев месячного цикла. Употребление меда положительно отражается на внешности — кожа становится мягче и моложе, волосы укрепляются и перестают выпадать.

Мед полезен при беременности, он насыщает полезными веществами не только организм матери, но и плод. Полезные свойства продукта способствуют здоровому формированию нервной и костной системы младенца.

НО надо помнить, что мед в сотах — достаточно аллергенный продукт. Перед его употреблением, особенно во время беременности, нужно убедиться, что он не вызовет негативной реакции организма и не принесет вреда.

Для детей

Велика польза пчелиных сот с медом для детей. Продукт улучшает память и умственные способности ребенка, повышает концентрацию и усидчивость. В постоянном рационе он защищает малышей от простудных заболеваний и хронической усталости, положительно влияет на пищеварение и нервную систему ребенка, повышает иммунитет.

В то же время, родителям необходимо помнить, что сам продукт и отдельные присутствующие в нем вещества часто вызывают сильную аллергию и могут причинять вред. Давать соты детям разрешается только после 3 лет и в минимальных количествах, чтобы убедиться, что негативной реакции не последует.

Внимание! Поскольку даже свойства полезного продукта способны приносить серьезный вред при противопоказаниях, перед вводом в рацион необходимо посоветоваться с врачом-педиатром.

Можно ли есть мед в сотах при похудении

Несмотря на то, что калорийность у меда средняя, вреда это не наносит, и к употреблению на диете он очень рекомендован. Дело в том, что свойства продукта увеличивают секрецию желудка и способствуют более быстрому пищеварению. Поэтому из организма выводятся шлаки и токсические вещества, что ускоряет процесс избавления от лишних килограммов.

Как правильно есть мед в сотах

Медовые соты выглядят довольно необычно, и зачастую бывает трудно разобраться, как именно их следует есть. Существует несколько основных правил употребления.

  • Чтобы продукт принес наибольшую пользу, его необходимо жевать в первозданном виде, не извлекая из сот.
  • Для разжевывания необходимо брать небольшие кусочки примерно 2 на 2 см размером.
  • В процессе жевания мед должен выдавливаться из ячеек, а сами соты — превращаться в плотный восковой шарик. Обычно тщательное разжевывание кусочка сот занимает около 5 минут.

Воск, из которого сделаны соты, принято выплевывать. Его будет полезно подержать во рту, но проглатывать кусочек не стоит. В лучшем случае он просто окажется бесполезным, а в худшем — поспособствует возникновению расстройства, поскольку окажет раздражающее действие на стенки желудка.

Суточная норма употребления

Полезные свойства меда в сотах смогут проявиться только при умеренном употреблении. Мёд обладает большой питательностью и высокой калорийностью, поэтому в сутки разрешено съедать не больше 100 г. Для детей эту дозировку следует значительно сократить — дневная норма составит всего 40 г продукта.

Вред сотового меда и противопоказания к употреблению

При всей пользе и ценных свойствах продукта при определенных состояниях он запрещен к употреблению. Органические кислоты и другие элементы в составе могут нанести вред:

  • при панкреатите, гастрите и язве в стадии обострения;
  • при тяжелых недугах желчного пузыря;
  • при камнях в почках и мочевыводящих путях;
  • при аллергии на мед и отдельные вещества в его составе.

С разрешения врача употреблять мед из сот нужно при сахарном диабете, недугах печени и онкологии, так как продукт может принести как пользу, так и вред.

Польза и вред пчелиных сот

Многие люди задаются вопросом, насколько велика польза медовых рамок, а иными словами, самих восковых сот. Определенное лечебное воздействие соты при проглатывании действительно оказывают.

Несмотря на то, что воск по причине высокой температуры плавления не переваривается в желудке, он собирает в себя и связывает токсины, присутствующие в организме. Соответственно, проглатывание небольших кусочков воска может принести пользу и поспособствовать очищению пищеварительного тракта.

Но если проглатывать медовые соты целиком слишком часто, от этого определенно будет вред. Плотный воск начнет накапливаться в желудке и кишечнике, а это чревато не только механическим раздражением слизистых, но и возникновением непроходимости. Поэтому специалисты советуют не глотать пчелиные соты нарочно, но и не пугаться, если небольшое количество воска было проглочено случайно.

Как выбрать мед в сотах

Большинство людей покупает мед в сотах на рынке, и в процессе необходимо обращать внимание на качество продукта.

  • Прежде всего, ячейки на куске пчелиных сот должны быть запечатанными. Герметичность может быть нарушена только по бокам, если мед продается отрезными кусками, но центральная часть должна оставаться целой.
  • По цвету соты должны быть светло-желтыми. Если они слишком темные, это означает, что мед из них уже откачивали несколько раз, после чего снова возвращали восковые ячейки в улей.
  • Не рекомендуется покупать слишком сухие или замороженные соты. В обоих случаях мед теряет большую часть полезных свойств.

Как хранить сотовый мед

Оптимальные условия хранения для меда в сотах — холодильная камера с невысокой влажностью и температурой от + 3-10 °С. Свежие соты рекомендуется расфасовывать по пластиковым контейнерам с герметичной крышкой — металлическая тара для хранения не подходит, мед испортится и начнет приносить вред. Лежать в контейнере соты должны свободно, если укладывать их слишком плотно, то отдельные куски слипнутся между собой. При соблюдении условий продукт сохраняет свойства вплоть до 2 лет.

Как вы видите, польза и вред меда в сотах зависят от дозировки и от отсутствия индивидуальной аллергии. Если соблюдать основные правила употребления продукта, то сотовый мед окажет крайне благотворное воздействие на организм и окажет влияние на укрепление организма.

Мед в сотах в подарок в магазине Все свое онлайн

Мед в сотах в подарок в магазине Все свое онлайн

Купить вкусный натуральный мед в сотах с пасеки в Москве и Московской области можно в магазине ВСЕ СВОЕ онлайн — интернет магазине свежих фермерских продуктов и товаров российских производителей. Для Вас мы подбираем только самые лучшие, полезные, вкусные продукты, произведенные в экологически чистой местности. В нашем интернет магазине vsesvoe.online вы можете купить натуральный мед, продукты пчеловодства: перга, прополис, пчелиное маточное молочко, башкирский — липовый, гречишный, цветочный, мед в орехами, с курагой, с арахисом и грецким орехом. Мед в подарочных наборах, свежую красную икру наивысшего качества. Вы сможете купить подарок мужчине, женщине, маме, папе, бабушке и дедушке, коллегам и друзьям и будьте уверенны, этот подарок не заброшен в дальний угол, а будет напоминать вечерами с теплым чаем о вашей заботе. В интернет магазине ВСЕ СВОЕ онлайн https://vsesvoe.online вы сможете купить вкусные и полезные подарочные наборы с медом и красной, черной икрой.

Сотовый мед – КФХ «Дар»

Сотовый мёд – это законсервированный пчёлами мёд, находящийся в восковых ячейках, предназначен для питания улья в зимнее время. Мёд в сотах считается самым качественным и полезным. Превосходит все известные сорта, так как содержит такие компоненты, которых нет ни в одном виде мёда. Является уникальным природным продуктом, к которому не прикасалась рука человека. Является хранилищем натуральных микроэлементов, ферментов и витамин.

С давних времён, благодаря своей ценности, сотовый мёд служил лучшим подарком, принимался в виде оброка и дани. Сейчас в торговле, из-за высокой цены, занимает мизерную долю среди медовой продукции.

Полезные свойства мёда в сотах

Сотовый мёд в отличие от всех видов мёда обогащён пыльцой, прополисом, воском. Содержит аминокислоты, макро- и микроэлементы, ферменты, природные антибиотики. Состав зависит от вида растения, с которого собиралась пыльца. Если использовать средние показатели, то углеводы составляют 82%, белки – 0,8%, вода – 17%, жиры полностью отсутствуют. Углеводы на 40 % состоят из фруктозы, 0,5% занимает сахароза, 35% – глюкоза, 2% – протеин. По калорийности мёд в сотах сопоставим с бараниной, белым хлебом и сгущенным молоком.

Процент полезных элементов невозможно сопоставить не с одним сортом мёда, так как его структура и химический состав остаются неизменными и полностью соответствуют натуральному составу, так как не соприкасались ни с какими веществами (предметами хранения и транспортировки).

Как сотовый мёд влияет на организм

О пользе мёда известно всем, но сотовый мёд действует иначе. Этот продукт едят вместе с сотами, поэтому воск частично при пережевывании попадает в ЖКТ и действует как абсорбент, очищающий организм от вредных элементов и улучшающий процессы выведения токсинов и шлаков.

Соты с мёдом полезны для дыхательной системы, снимают многие проблемы связанные со стоматологией. Наличие прополиса способствует устранению боли различного происхождения. Мёд в сотах обладает иммуногенным, бактерицидным, ранозаживляющим, противогрибковым действием. Укрепляет сердечнососудистую систему, улучшает состояние при язве желудка, излечивает гинекологические заболевания, омолаживает, улучшает состав крови и состояние сосудов.

Продолжительное пережёвывание медовых сот способствует устранению болезнетворных бактерий из полости рта и желудочно-кишечного тракта, помогает бороться с простудой и высокой температурой. Положительно действует на нервную систему, устраняет симптомы перенапряжения, неврозов, повышенной возбудимости, усталости, депрессии. Лечит бессонницу, заболевания глаз, включая катаракту.

Как правильно выбирать мёд в сотах

Покупать мёд в сотах лучше на ярмарках мёда, у пасечников или на рынке. Его продают прямоугольными вырезками или целыми рамками. Цвет продукта может разниться от белого до различных вариаций жёлтого, всё зависит от видов растений, с которых пчёлы собирали нектар. Цвет сот не должен отличаться от цвета мёда. Ячейки в обязательном порядке закрыты воском. Свойствами сотового мёда является жидкое состояние, он долго не кристаллизуется.

Способы хранения

Сотовый мёд хранится в стеклянной или керамической таре. Для этого соты разделяют на небольшие полоски. Посуда должна быть сухой, чистой и иметь крышку. Чтобы продукт долгое время не терял полезных свойств нужно поместить ёмкости с сотами в тёмное и прохладное помещение. При таких условиях мёд будет оставаться качественным несколько лет. По истечению первого года хранения могут появиться признаки кристаллизации. Недопустимо держать продукт при температуре выше +30, так как снижается полезная ценность мёда.

С чем сочетается в кулинарии

Сотовый мёд используется как самостоятельный продукт. Употребляется вместе с сотами. Пережёвывать следует каждый кусочек не менее 5 минут, затем воск удаляется. При желании употребить продукт полностью нужно есть его с чёрным хлебом.

Полезное сочетание продуктов

Мёд в сотах, по сравнению с обычным мёдом, имеет меньшую калорийность. Углеводы на 85% состоят из фруктозы и глюкозы. Следящие за фигурой и желающие похудеть могут включать этот полезный продукт в свой рацион. Съедая один раз в день по небольшому кусочку сотового лакомства можно пополнить организм полезными веществами в период диет и воздержаний. Правильным использованием считается приём после еды, с тщательным пережёвыванием воска. Взрослые могут употреблять ежедневно до 100 г мёда в сотах, а дети до 40-50 г.

Противопоказания

Противопоказано при аллергических реакциях.

Применение в медицине и косметологии

Польза сотового мёда очевидна. Особенной эффективно использовать этот продукт при заболеваниях носоглотки и дыхательных путей. Пережёвывание сот сравнимо с жевательной таблеткой. Снимает боли в горле, снижает позывы кашля, очищает от болезнетворных микробов ротовую полость. Пользу оказывает не только мёд и воск, но и крышечки сот и частички пыльцы. Жевание продукта рекомендуется при проблемах со слизистой ротовой полости и дыхательных путей. Воск содержит прополис, поэтому отлично очищает зубы, укрепляет эмаль, служит профилактикой кариеса.

В народной медицине медовые соты используют как нейтрализатор аллергических реакций. Рекомендуют при отравлениях и интоксикации, для вывода вредных веществ и очищения организма. Благодаря стерильности сотового мёда его применяют для лечения глазных заболеваний. Мёд, разбавленный кипячёной (2 ч. л. воды на 1 ч. л. мёда без воска) закапывают в глаза при конъюнктивите, катаракте, при попадании инородного тела и слезоточивости. Ещё в старину мёд в сотах применяли для лечения язвы желудка, для очищения зубов и кишечника от болезнетворных бактерий.

Для подавления простудных заболеваний медики советуют жевать медовые соты не менее 5 минут по 3-5 раз в день. Продукт популярен как сильное потогонное средство для снижения температуры. Назначается для лечения бессонницы, заболеваний сердечнососудистой системы и ЖКТ, для устранения гинекологических недугов и при расстройствах нервной системы (неврозы, стрессы). Для снятия проблем со сном вечером рекомендуется выпивать стакан тёплой воды, в которую добавлена 1 ст. л. сотового мёда.

В косметологии используют в составе масок, лосьонов, скрабов, для медовых обёртываний и массажа. Сотовый мёд эффективно тонизирует, способствует омоложению, устранению мелких морщин.

Состав и калорийность меда ❤️🐝

Наблюдения показали, что спортсмены, употребляющие много сахара, значительно выносливее. Однако сахар (свекловичный, тростниковый) и глюкоза усваиваются нашим организмом по-разному. В то время как глюкоза без всяких превращений поступает из кишечника в кровь (ее можно вводить непосредственно в кровь, что широко практикуется при многих заболеваниях), сахар должен предварительно подвергнуться гидролизу — расщеплению.

Гидролиз сахара происходит только в тонких кишках, где под воздействием кишечного сока сахар расщепляется на глюкозу и левулезу, которые затем всасываются и поступают в кровь воротной вены. Из воротной вены глюкоза попадает в печень, откуда током крови распределяется по тканям организма (рис. 10).

Более полноценным по сравнению с сахаром является мед, который содержит кроме легкоусвояемых сахароз еще и другие ценные питательные вещества. Глюкоза быстро переходит в кровь и становится

хорошим источником энергии. Поэтому для восстановления сил организма после тяжелого физического труда, в случаях болезни и т. д. рекомендуется потребление меда.

Спортсмены едят мед перед состязаниями или в перерывах между ними, чтобы израсходованную мускульную энергию опять быстро восстановить. С этой же целью врачи рекомендуют мед старым людям и детям, также иногда нуждающимся в быстром восстановлении сил.

Мед представляет собой почти чистую глюкозу и левулезу, поэтому является полезнейшим продуктом питания. Кроме того, в состав меда входят вещества (ферменты, минеральные соли, витамины и др.), необходимые для нормальной жизнедеятельности клеток, тканей и органов. Ферменты — это тот чудесный эликсир, о котором мечтали алхимики средневековья, это более совершенное и изумительное орудие организма, чем самые совершенные реактивы в руках опытного химика.

Чтобы вызвать гидролиз крахмала, химики нагревают его с водой в запаянных трубках или автоклаве до температуры 170°С. Но значительно быстрее этот процесс идет под влиянием фермента слюны — птиалина. Омыление жира происходит при высокой температуре (более 100°С) при кипячении с щелочами, тогда как в организме это совершается пор влиянием фермента липазы при температуре тела.

Какие ничтожно малые количества фермента необходимы для активного ферментативного действия, можно представить себе на примере пероксидазы, выделенной академиком А. Н. Бахом из хрена и оказавшейся активной даже в разведении 1: 200 000 000. Известный немецкий ученый Цандер (1931) объяснял исключительные свойства меда наличием в нем ферментов. Он считал, что ферменты изменяют мертвую смесь веществ, приносимых летными пчелами в улей, соответственным образом в живое вещество, которое потом и вне тела пчелы производит работу, зреет и отмирает.

Доктор Анна Маурицио также считает, что ферментативные процессы не прекращаются и после того, как пчелы запечатают мед в сотах, эти процессы продолжаются и во время хранения его. В Швейцарии в одном старом доме был найден мед, собранный пчелами еще в 1895 г. Меду было уже примерно 60 лет, когда сделали анализ и хроматограмма оказалась точно такой, какую ожидали: на ней были видны яркие пятна фруктозы и глюкозы, а также следы негидрализованной сахарозы и типичные пятна мальтозы и олигосахаридов.

Значение минеральных солей для организма очень велико. Эксперименты показали, что при кормлении пищей, в которой отсутствовали минеральные соли, хотя в ней и имелся избыток белков, углеводов, жиров и витаминов, подопытные животные погибали. А. Войнар указывает, что микроэлементы и минеральные вещества, встречающиеся в организме в незначительных концентрациях, играют исключительно важную биологическую роль, так как благодаря взаимоотношению с рядом ферментов, витаминов и гормонов влияют на возбудимость нервной системы, на тканевое дыхание, процессы кровообращения и т. д.

В связи с возрастными изменениями обмена веществ колеблется уровень содержания в крови и органах таких важных в биологическом отношении микроэлементов, как медь, марганец, кобальт, никель, цинк и др. В таких случаях введение этих элементов с пищей, в частности с медом, особенно важно.

Пчелиный мед богат также и органическими кислотами— яблочной, винной, лимонной, молочной, щавелевой. По этому вопросу Цандер писал, что о природе кислот в меде раньше говорилось много вздорного. Так, существовало общее убеждение, что будто бы кислотность эта обусловливается присутствием муравьиной кислоты, которую пчелы перед запечатыванием меда вносят посредством жала из ядовитых желёзок в мед для его консервирования.

В пчелином меде содержатся также витамины, ацетилхолин, антибактериальные и антимикологические (противоплесневые), фитонцидные, гормональные, антидиабетические и другие весьма важные для организма вещества.

Академик В. П. Филатов высказал мнение, что пчелиный мед содержит биогенные стимуляторы, т. е. вещества, повышающие жизнедеятельность организма.

В ботаническом саду Львовского государственного университета проведены интересные опыты, показавшие, что пчелиный мед содержит ростовые вещества — биосы. Ветки, отделенные от дереза и высаженные в землю после обработки водным раствором меда, быстро укоренялись и нормально росли.

В состав меда входят также соли кальция, натрия, калия, магния, железа, хлора, фосфора, йода, а некоторые сорта меда содержат даже радий. Количество некоторых минеральных солей в меде почти одинаково с содержанием их в сыворотке крови человека (табл. 1).

При спектральном анализе гречишного и полифлерного (собранный с разных цветов) меда, проведенном в лаборатории Московского государственного университета имени М. В. Ломоносова, установлено, что мед содержит также соли марганца, кремния, алюминия, бора, хрома, меди, лития, никеля, свинца, олова, титана, цинка и осмия; при исследовании сортов меда Челябинской области обнаружили в них повышенное содержание молибдена, меди, титана, серебра, бериллия, ванадия и циркония.

Ст. Младенов (Болгария) отмечает также в составе меда наличие висмута, галлия, германия, золота. Таким образом, по данным ряда исследователей, мед содержит: алюминий, барий, бериллий, бор, ваннадий, висмут, галлий, германий, железо, золото, калий, кальций, кремний, литий, магний, марганец, медь, молибден, натрий, никель, радий, свинец, серебро, стронций, титан, фосфор, хром, цинк, цирконий.

Доказано, что минеральный состав различных сортов пчелиного меда зависит от почвы, на которой произрастают цветущие медоносные растения.

Мед — высококалорийный продукт: килограмм его содержит от 3150 до 3350 калорий. Мед — весьма ценный диетический продукт, который применяют одновременно с лекарствами и используют для лечебных целей. Он получил должное признание и применяется в современной клинике и в лечебно-профилактических учреждениях.

Узнаем можно ли поправиться от меда? Сколько меда можно съедать в день? Калорийность меда

Мед – это натуральный продукт. Иначе его называют – природный сахар. Как и любой другой сладкий продукт, мед достаточно калорийный. Из этого следует вполне разумный ответ на вопрос о том, можно ли поправиться от меда. Можно, особенно если есть его много.

Мед, в свою очередь, очень полезен. Если не злоупотреблять этим лакомством и есть его в разумных количествах, то никакого вреда для фигуры не будет. Плюсы и минусы меда, как правильно его есть, чтобы оставаться стройным, – обо всем этом и поговорим в статье.

Калорийность меда

Если речь идет о том, можно ли поправиться от меда, то стоит учесть калорийность продукта. В среднем она составляет 308 ккал на 100 грамм. В чайной ложке меда – 24,6 ккал, а в столовой – 36,9 ккал. Подумайте только, в 200 граммах меда 618 ккал, а это практически столько же, сколько в 170 граммах сыра, 480 граммах белой рыбы и килограмме яблок!

Также калорийность меда не так далеко ушла от калорийности сахара. Только вот мед не содержит клетчатки, а это значит, что он полностью усваивается организмом. Можно ли поправиться от меда? Да, если есть его в больших количествах.

Состав меда

Мед практически состоит из сахаров (на 77 %). В его состав входят:

  • глюкоза;
  • сахароза;
  • мальтоза;
  • левулеза;
  • вода;
  • минеральные соли.

Мед – это настоящий кладезь энергии. Его полезно есть спортсменам, болеющим людям и тем, кто выполняет сложную физическую работу. Для людей из этого списка даже 100 грамм меда не повредит, а вот остальным необходимо ограничить себя в употреблении продукта. Иначе можно быстро набрать лишний вес.

Можно ли поправиться от меда?

Несмотря на то, что в меде достаточно много калорий, существуют разнообразные медовые диеты. Худеющие люди сидят на них и получают хорошие результаты. Тогда как правильно звучит ответ на вопрос: «Можно ли поправиться от натурального меда»? Для начала давайте разберемся, почему же люди набирают лишние килограммы.

Вот основные причины набора жировой массы:

  • Гиподинамия или малая подвижность. Продукты дают энергию организму. Если съесть больше, чем нужно организму, то полученную энергию просто необходимо потратить. Если этого не сделать, то набор лишнего веса гарантирован.
  • Поглощение большого количества еды. Проще говоря, поправиться можно даже от обычных зеленых яблок, если есть их в огромных количествах. Мед же содержит намного больше калорий, чем яблоки. Чтобы превысить суточную норму калорий, достаточно лишь съесть 500 грамм меда женщине и 600 – мужчине (при этом больше ничего не употреблять в течение дня).
  • Употребление продуктов, содержащих большое количество калорий. Это одна из самых главных причин набора лишнего веса. Если на своей диете вы все же решили съесть что-то сладкое и калорийное, то пусть это будет мед. Он хоть и калориен, как сдоба, но намного полезнее шоколада, сахара и жирных тортов.

В итоге, отвечая на вопрос о том, толстеют ли от меда, стоит сказать однозначно – «да». Но если есть мед в умеренных количествах и двигаться в течение дня, то все съеденные калории исчезнут без следа. Небольшой совет: замеряйте заранее, сколько вы меда хотите съесть. Лучше, если вы взвесите мед на специальных весах.

Сколько меда можно съедать в день?

Не более 5 чайных ложек! Это примерно 120 ккал. Причем вы должны учитывать эти калории и вписывать их в свой дневной рацион. Лучше, чтобы эти ложки меда были съедены в первой половине дня, так вы успеете израсходовать энергию, полученную из меда. Некоторые думают, что пара ложек меда перед сном не навредит, но это совсем не так. Иногда из-за этого съеденного меда у человека не получается похудеть. А со временем мед перед сном может стать причиной набора лишних килограммов.

Как есть мед и быть стройным?

Частично на этот вопрос было отвечено выше – нужно просто соблюдать меру. Но есть еще несколько моментов, которые стоит учитывать при употреблении этого продукта:

  1. Нельзя нагревать мед выше 50 °С, так он потеряет все свои лечебные и питательные свойства. Многие, кто сидит на диете, готовит «легкую выпечку», в которой сахар заменяется на мед. Этих людей ждет разочарование, ведь при нагреве свойства меда становятся похожими на свойства обычного белого сахара.
  2. Нельзя употреблять мед калорийных сортов (например, мед с орехами).
  3. Нельзя употреблять мед вместе с другими калорийными продуктами. Например, мед с белым хлебом или плюшкой.
  4. Мед повышает аппетит, поэтому его стоит есть с осторожностью.

Плюсы меда

Мед употребляют в пищу уже много веков, и все это время люди пользовались его лечебными свойствами. Три тысячи лет назад древние греки уже лечили медом простуду и желудок. Мед в качестве лекарства популярен и пой сей день.

Вот еще несколько достоинств меда:

  1. Мед состоит из ферментов, которые просто необходимы организму человека. Среди этих микроэлементов: магний, калий, фосфор, железо и йод. Также в меде есть витамины В2 и В6, фолиевая кислота и пантотеновая кислота.
  2. Мед обладает бактерицидным действием. Пчелы вырабатывают вещество, которое помогает бороться с бактериями.
  3. Мед никогда не плесневеет, он только засахаривается. Любой грибок, попавший в мед, тут же погибает.

Но медом не стоит запасаться впрок, даже если вы хотите использовать его в лечебных целях. Хранить мед можно только один год. После года хранения в меде значительно снижается уровень витаминов, противомикробные действия пропадают, а остается лишь одна сахароза, которая может только навредить фигуре.

Противопоказания и вред меда

Нет сомнения, что мед очень полезен. Но даже в лечебных целях его нужно употреблять в меру. Сколько меда можно съедать в день в лечебных целых?

  • Для взрослого – по столовой ложке три раза в день. Курс лечения – не более двух недель.
  • Для ребенка – одна столовая ложка в день.
  • Для пожилых людей – одна-две чайные ложки в день.

Зимой стоит есть на одну чайную ложку меда больше, а вот летом стоит отказаться от меда или есть его в два раза меньше.

Когда мед следует принимать с осторожностью:

  1. При кормлении грудью. Необходимо следить за реакцией ребенка на данный продукт. Во время беременности мед можно есть в таких же дозах, которые разрешены взрослому человеку. Мед нисколько не навредит здоровью ребенка и будущей мамы. Наоборот, он поможет поднять уровень гемоглобина, что так необходимо беременной женщине.
  2. При наличии аллергии. Хотя аллергия на мед встречается очень редко, но все же стоит ознакомиться с ее симптомами: зуд, боль в животе, отек гортани, тошнота, повышение температуры тела.
  3. В малом возрасте. Детям до трех лет стоит давать этот продукт в малых количествах. Например, для начала можно дать немного меда на кончике чайной ложки, чтобы определить, есть ли у ребенка аллергия на данный продукт.
  4. При наличии следующих заболеваний: астма, мочекаменная болезнь, сахарный диабет, сердечно-легочная недостаточность, острый панкреатит, гастрит, лихорадка.

В заключение

Мед – это прекрасный продукт, который приносит пользу организму, если употреблять его в небольших количествах. Толстеют ли от меда? Да, если есть его в больших количествах, и нет, если употреблять его в пределах нормы.

Энергетическая ценность меда. Пчеловодство для начинающих

Читайте также

Глава 2. Питательная ценность грибов

Глава 2. Питательная ценность грибов Дикорастущих грибов с каждым годом становится все меньше и меньше, особенно вблизи больших городов. А употреблять эти грибы в пищу все опаснее из-за накопления в них вредных для человека веществ. Поэтому неслучайно возник интерес к

В чем ценность жимолости?

В чем ценность жимолости? Самая ее большая ценность состоит в том, что ягоды жимолости попадают на наш стол рано, когда еще нет даже земляники. В ягодах большое количество калия, кальция, есть магний, железо, кремний, медь, цинк, йод и другие микроэлементы. Жимолость

Кристаллизация меда в сотах

Кристаллизация меда в сотах Сахарный сироп густой консистенции пчелы складывают и запечатывают в ячейки без предварительной переработки, что может зимой привести к его кристаллизации.Засахарившийся мед можно узнать по крупинкам сахара на полу улья. В этих случаях надо

Откачивание меда

Откачивание меда Откачка меда производится в изолированном помещении. Медогонку устанавливают на подставке над ведром. На кран вешают ситечко для процеживания меда. Нагретым в горячей воде ножом с запечатанных медовых сотов снимают восковые крышечки. Распечатанные

Пищевая ценность грибов

Пищевая ценность грибов Грибы имеют невысокую калорийность, поскольку содержат мало жиров и углеводов. Средняя калорийность 1 кг грибов не превышает 300–500 ккал, в то время как 1 кг жира содержит 9100 ккал, а 1 кг мяса – 4100. В то же время грибы содержат значительное

Пищевая и лечебная ценность земляники

Пищевая и лечебная ценность земляники Плоды садовой земляники обладают хорошими вкусовыми свойствами, удачным набором пищевых веществ и являются прекрасным продуктом питания. В плодах этой культуры содержится 7,2 % Сахаров, 4 % клетчатки, 1,3 % органических кислот;

В чем ценность биогумуса

В чем ценность биогумуса • Высокая микробиологическая активность, то есть биогумус легко усваивается растениями, натуральный азот, фосфор и калий в биогумусе идеально сбалансированы между собой. • Экологичность – биогумус – удобрение абсолютно натуральное и

Ситечки для процеживания меда

Ситечки для процеживания меда Сделаны они из луженой стали, размеры их ячеек от 1 до 3 мм. Сито с крупными ячейками ставится на сито с мелкой ячейкой. Применяются только для процеживания и очистки меда от воска, прополиса и других посторонних

Откачка меда

Откачка меда Когда приходит время качать мед, откладывайте все остальные дела. Сколько на это требуется времени? При ручной медогонке с двух часов дня до вечера пару ульев освободишь от магазинов и скачаешь с четырех надставок мед. Всего сорок восемь магазинных рамок.

Состав меда

Состав меда Одни источники сообщают, что в нем содержится ни много ни мало, а более 300 химических и зольных веществ; другие идут дальше, уверяя, что в меде зафиксировано их более 500. Кто считал? Как? Когда? Об этом ни слова.Как ни крути, обе цифры внушают большое уважение к

Кристаллизация меда

Кристаллизация меда Мед кристаллизуется за два-три месяца. Засахаривается, или как говорят пчеловоды, «садится». Это естественный процесс, при котором мед меняет свой цвет. Только мед в сотах, да с белой акации долго хранится в жидком виде.Кристаллизация зависит от мелких

Тара для меда

Тара для меда Лучшей тарой для жидкого меда, чем стеклянная посуда, пока ничего не придумано. Стекло само по себе химически нейтрально и не влияет на качество сохраняемого продукта.Для длительного хранения больших запасов меда применяют липовые и буковые бочки (в

Лечебные свойства меда

Лечебные свойства меда Мед – поистине уникальное природное вещество, без которого вся наша жизнь, абсолютно точно, была бы менее привлекательной и радостной. Для древнего человека мед был самой желанной сладостью, за которой он постоянно охотился. Для человека

Хлопья с сотами для меда, 12,5 унций (354 г)

Зерновые с хлопьями для медовых гребешков, 12,5 унций (354 г) | Обряд помощи

Магазин не будет работать корректно, если куки отключены.

Похоже, в вашем браузере отключен JavaScript. Для наилучшего взаимодействия с нашим сайтом обязательно включите Javascript в своем браузере.

Вы успешно зарегистрировались

{{#if error}} {{/если}} {{успех}} {{/в}} {{/в}} {{/в}}

{{#genertatePrescriptionText PharmacyDetails. считать}} Ваши {{count}} {{предписания}} {{status}} {{/ genertatePrescriptionText}}

логин Пожалуйста, войдите в свою учетную запись аптеки

{{/в}}

Добавить Управление аптек

{{/в}} {{/в}} {{/в}} {{/в}} {{/в}}

Продукты для снятия аллергии. В Магазин

{{/в}} {{/в}} {{/в}} {{/в}}

От производителя

ИНФОРМАЦИЯ О ПРОДУКТЕ

Арт. 0363890


Питательные подслащенные кукурузо-овсяные хлопья. Превосходный источник витамина D. Количество и% дневной нормы на порцию: 130 калорий (7%), 0 г насыщенных жиров (0%), 180 мг натрия (8%), 10 г сахара (суточная норма A% для сахаров не установлено), 750 МЕ витамина А (15%), 100 МЕ витамина D (25%). Почему витамин D? Многие дети не получают достаточного количества витамина D. Важен для здоровья растущего ребенка. Способствует здоровью костей и зубов, помогая организму усваивать кальций.Наслаждайтесь большим вкусом меда и большим кусочком Honeycomb Cereal! Каждая порция помогает начать день здоровым образом: отличный источник 6 витаминов группы В; Всего 10 незаменимых витаминов и минералов; 8 г цельного зерна на порцию; С низким содержанием жиров и без холестерина. Сотовые хлопья также являются отличной закуской! Цельнозерновые: 8 г или более на порцию. Ешьте 48 г или более цельнозерновых продуктов в день. Сделайте мир лучше, по одной коробке! Знаете ли вы, что повторное использование этого сотового ящика может помочь изменить мир? Переработка помогает защитить окружающую среду для будущих поколений. Он также удерживает отходы на свалках, что снижает выбросы парниковых газов, которые способствуют изменению климата. Как одна коробка может иметь такое большое значение? Вот несколько идей для начала! Рециркулировать! Сохранить! Повторное использование! Стеллажи для вторичной переработки: Факт. В среднем в домохозяйство ежегодно поступают сотни мусорных почтовых отправлений. Неудивительно, что большая часть отходов на свалках приходится на бумагу. Когда бумага разлагается, она выделяет метан — неприятный парниковый газ, связанный с глобальным потеплением. Довольно обидно, учитывая, что большая часть бумаги полностью пригодна для вторичной переработки! Идея: не сваливайте! Превратите свою пустую коробку в корзину для мусора, чтобы собирать нежелательную почту, журналы и газеты.В дни сбора бумаги в вашем районе опустошите полку и снова наполните ее! Стань большим: создай в школе несколько стеллажей для мусора! Создайте стойки для мусора для всех своих классов в школе, чтобы напоминать всем о том, что нужно собирать и перерабатывать бумагу, чтобы она не попадала на свалки. Воспользуйтесь этим ящиком сейчас! Инструкции внутри. Станция кормления пчел: Факт: медоносные пчелы таинственным образом исчезают из-за явления, называемого расстройством коллапса колонии. В дополнение к производству меда для хлопьев Honeycomb, медоносные пчелы опыляют большинство продовольственных культур в мире.Это много важного шума вокруг! Идея: Сделайте что-нибудь сладкое для пчел! Используйте свои пустые соты, чтобы создать станцию ​​для кормления пчел, которая станет источником пищи для местных медоносных пчел! Стань большим: вместе со своей школой или городом разместите сады для кормления пчел в местных школьных дворах и городских парках! Какой прекрасный способ помочь пчелам! Необходимо 3 сотовых ящика. См. Инструкции в Интернете. Экологичная папка: Факт: чем больше люди используют бумаги, тем больше деревьев нужно срезать. Миллионы акров леса ежегодно теряются из-за чрезмерного потребления бумаги.Для производства всего одного фунта бумаги требуется почти четыре фунта древесины и производится три фунта углекислого газа! Плохо, если вы дерево — или кто-то, кто любит дышать чистым воздухом! Идея: спасти дерево! Создавайте школьные папки из пустых сотовых ящиков, и вы сэкономите не только бумагу, но и деньги на школьные принадлежности! Стань большим: организуй вечеринку по изготовлению папок в школе! Если каждый будет делать папки из своих коробок для хлопьев Honeycomb вместо того, чтобы покупать их в бумажных компаниях, подумайте, сколько деревьев будет спасено! Требуются 2 сотовых ящика. См. Инструкции в Интернете. Обмен: 1-1 / 2 крахмала. Расчет обмена основан на материалах «Выбери свою пищу: списки обмена для диабета», 2008 г., Американской диабетической ассоциации и Американской диетической ассоциации.

БОЛЬШЕ ИНФОРМАЦИИ

Дополнительная информация
Название продукта Хлопья для меда в сотах — 12.5 унций
Суббренд Гребень для меда
Количество в упаковке 1
Увеличенный размер 12,5 унций (354 г)
Предпочтение ингредиентов Цельное зерно
Опора 65 Нет

ИНГРЕДИЕНТЫ

Кукурузная мука, сахар, цельнозерновая овсяная мука, цельнозерновая кукурузная мука, мед, соль, желтый цвет 5. BHT добавлен в упаковочный материал для сохранения свежести продукта. Витамины и минералы: ниацинамид (витамин B), пониженное содержание железа, оксид цинка (источник цинка), витамин B6, пальмитат витамина A, рибофлавин (витамин B2), мононитрат тиамина (витамин B1), фолиевая кислота (витамин B), витамин D , Витамин B12.
Калорий: 0
Калорий из жиров: 0
Всего жиров: 1 г (2%)
Полиненасыщенные жиры: 0 г
Мононенасыщенные жиры: 0 г
Натрий: 180 мг (8%)
Калий: 50 мг (1%)
Всего углеводов: 28 г (9%)
Пищевые волокна: 1 г (7%)
Сахара: 10 г
Другие углеводы: 17 г
Белки: 2 г
Витамин A: 0 (15%)
Железо: 0 (15%)
Кошерное: 0
Витамин D : 0 (25%)
Магний: 0 (4%)
Ниацин: 0 (25%)
Фосфор: 0 (4%)
Витамин B12: 0 (25%)
Витамин B6: 0 (25%)
Цинк : 0 (10%)
Рибофлавин: 0 (25%)
Тиамин: 0 (25%)
Фолиевая кислота: 0 (25%)
Транс-жиры: 0 г
Размер порции в граммах: 32 г
Пшеница: 0
Калорий: 0
Калорий из жиров: 0
Всего жиров: 1 г (2%)
Полиненасыщенные жиры: 0 г
Мононенасыщенные жиры: 0 г
Натрий: 245 мг (10%)
Калий: 250 мг (7%)
Всего углеводов: 34 г (11%)
Пищевые волокна: 1 г (4%)
Сахар: 16 г
Прочие углеводы: 17 г
Белки: 6 г 90 032 Витамин A: 0 (20%)
Кальций: 0 (15%)
Железо: 0 (15%)
Кошерное: 0
Витамин D: 0 (40%)
Магний: 0 (8%)
Ниацин: 0 (25%)
Фосфор: 0 (15%)
Витамин B12: 0 (35%)
Витамин B6: 0 (25%)
Цинк: 0 (10%)
Рибофлавин: 0 (35%)
Тиамин: 0 (30%)
Фолиевая кислота: 0 (25%)
ServingSize_Prepared: 2 чашки
Пшеница: 0

БЕЗОПАСНОСТЬ

Изготовлено на оборудовании по переработке пшеницы.

Отзывы

Закрывать

Подождите, пока действуют ваши скидки.

= «evenodd»>!

калорий в сотах. Пищевая ценность, ингредиенты и аллергены

Сумма за 1 сер
калорий 130 Ккал (544 кДж)
Калорий из жира 9 Ккал
% дневная стоимость *
Всего жиров 1 г 2%
Натрий 180 мг 8%
Всего углеводов 28 г 9%
Сахар 10 г 40%
Пищевые волокна 2 г 8%
Белок 2 г 4%
Витамин А 0. 5 мг 16%
Утюг 2,3 мг 13%

* Процент дневной нормы основан на диете в 2000 калорий. Ваши дневные значения могут быть выше или ниже в зависимости от ваших потребностей в калориях.
Узнайте, сколько калорий вам нужно съесть.

Питание для медоносных пчел — American Bee Journal

Как профессиональный диетолог на пенсии, работавший с большим разнообразием видов животных, мой подход к питанию медоносных пчел, вероятно, несколько отличается от подхода тех, кто прошел обучение в области энтомологии.На протяжении многих лет у меня была возможность работать с широким спектром ингредиентов, многие из которых лучше всего подходят для конкретных нужд различных видов животных. Самая большая проблема для питания медоносных пчел — это потребность в более полной и качественной информации о том, какие питательные вещества нужны медоносным пчелам, и возможность производить смесь ингредиентов, которая может быть уменьшена до размера пыльцы, которую пчелы будут легко потреблять, переваривать и переваривать. использовать для оптимальных функций организма. Многие ингредиенты могут обеспечивать подходящие питательные вещества, но обычно не в необходимых количествах, поэтому требуется множество ингредиентов, чтобы обеспечить все питательные вещества в нужных количествах, в которых нуждаются медоносные пчелы.

Медоносным пчелам, как и всем другим животным, нужна вода, белок, жиры, углеводы, витамины и минералы.

Вода должна поступать из чистого источника. Пчелы, кажется, любят бассейны, пруды и иногда «негигиеничные» источники воды. Я должен задаться вопросом, может ли это быть связано со вкусом воды. Это все равно, что сравнивать воду в бутылках с водой, в которую вы добавили ароматизатор. Что ты предпочитаешь пить?

Белки должны поступать в основном из пыльцы, которая должна расщепляться на аминокислоты, строительные блоки белка, пищеварительными ферментами пчел.После того, как белки расщепляются на аминокислоты, пчелы (и все другие виды) повторно собирают эти аминокислоты в определенные белки и ферменты, необходимые для всех функций организма. Пыльца из различных цветочных источников будет варьировать от 4% до 60% белка, в то время как летние потребности в белке медоносной пчелы находятся в диапазоне от 18 до 22% белка. Вот почему пчелам необходимо собирать пыльцу из различных растительных источников.

Жиры (правильнее называть липидами) происходят из пыльцы и, в меньшей степени, из нектаров, которые должны расщепляться на жирные кислоты, строительные блоки липидов / жиров.В то время как некоторые жирные кислоты с короткой цепью могут использоваться для получения энергии, жирные кислоты с более длинной цепью включаются в клеточные стенки пчел, чтобы помочь поддерживать клеточную структуру и функцию. Жирные кислоты с очень длинной цепью также могут использоваться пчелами для производства феромонов и репродуктивных гормонов.

Углеводы, которые могут быть получены из самых разных сахаров и крахмалов, используются в основном в качестве энергии для полета и работы в ульях, а также для приготовления меда и пчелиного хлеба. Некоторые углеводы также используются в качестве пищи для бактерий, которые ферментируют накопленную пыльцу и превращают ее в пчелиный хлеб для последующего употребления в пищу.Нектары являются основным источником простых сахаров (глюкозы и фруктозы), и содержание сахара будет варьироваться между различными видами растений от 5% до 75%. Пчелы предпочитают те цветочные источники с более высоким (сладким на вкус) содержанием сахара. Пчелы имеют ограниченную способность переваривать сырые крахмалы, как это обычно бывает в сырых зернах, но, по-видимому, они лучше переваривают приготовленные крахмалы. Сырой крахмал с большей вероятностью переваривается кишечными бактериями, чем самой медоносной пчелой, а слишком большое количество сырого крахмала в рационе приводит к жидким фекалиям и диарее у многих видов.

Хотя роль большинства витаминов и минералов не была четко продемонстрирована в научных исследованиях, я считаю, что можно с уверенностью предположить, что витамины и минералы играют у пчел такую ​​же основную биохимическую роль, как и у других видов. Единственным серьезным исключением из этого правила является витамин D и его роль в скелете позвоночных. Позвоночные животные (животные с позвоночником) используют минералы, особенно кальций, фосфор и магний, которые откладываются в белковой матрице, чтобы сформировать твердый внутренний скелет.У этих животных витамин D играет важную роль в регулировании отложения кальция в скелетном матриксе.

У насекомых же жесткий внешний скелет, а не внутренний. Это называется экзоскелет, и он основан на хитине. Хитин — это соединение на основе сахара, которое чем-то похоже на…

Имеют ли значение качество и разнообразие пыльцы?

Abstract

Колонии медоносных пчел сильно зависят от доступности цветочных ресурсов, из которых они получают питательные вещества (особенно пыльцу), необходимые для их развития и выживания.Однако в настоящее время на кормовых угодьях наблюдается интенсификация сельского хозяйства и изменение ландшафта. Таким образом, пчелы сталкиваются с неравенством во времени и пространстве в изобилии, типах и разнообразии растительных ресурсов, что может обеспечить неадекватное питание и подвергнуть опасности колонии. Благоприятное влияние наличия пыльцы на здоровье пчел хорошо известно, но остается неизвестным, могут ли качество и разнообразие рационов с пыльцой повлиять на здоровье пчел. Поэтому мы проверили влияние качества пыльцевого рациона (разная монофлорная пыльца) и разнообразия (полифлоральная пыльцевая диета) на физиологию молодых пчел-кормилиц, которые имеют отличную физиологию питания (например,грамм. развитие гипофарингеальной железы и уровень вителлогенина ), а также толерантность к паразиту микроспоридий Nosema ceranae путем измерения выживаемости пчел и активности различных ферментов, потенциально участвующих в здоровье и защитной реакции пчел (глутатион-S-трансфераза (детоксикация) ), фенолоксидаза (иммунитет) и щелочная фосфатаза (метаболизм)). Мы обнаружили, что качество пыльцы влияет на физиологию пчел-медсестер и на устойчивость к паразитам.Разнообразие пыльцевого рациона не повлияло на физиологию пчел-кормилиц и выживаемость здоровых пчел. Однако при заражении паразитами пчелы, которых кормили полифлерной смесью, жили дольше, чем пчелы, которых кормили монофлерной пыльцой, за исключением монофлерной пыльцы, богатой белком. Кроме того, выживаемость положительно коррелировала с активностью щелочной фосфатазы у здоровых пчел и с активностью фенолоксидазы у инфицированных пчел. Наши результаты подтверждают идею о том, что как качество, так и разнообразие (в конкретном контексте) пыльцы могут влиять на физиологию пчел и могут помочь лучше понять влияние сельского хозяйства и интенсификации землепользования на питание и здоровье пчел.

Образец цитирования: Di Pasquale G, Salignon M, Le Conte Y, Belzunces LP, Decourtye A, Kretzschmar A, et al. (2013) Влияние питания пыльцы на здоровье медоносных пчел: имеют ли значение качество и разнообразие пыльцы? PLoS ONE 8 (8): e72016. https://doi.org/10.1371/journal.pone.0072016

Редактор: Йохен Цейл, Австралийский национальный университет, Австралия

Поступила: 25 марта 2013 г .; Дата принятия: 4 июля 2013 г .; Опубликовано: 5 августа 2013 г.

Авторские права: © 2013 Di Pasquale et al.Это статья в открытом доступе, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License, которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе при условии указания автора и источника.

Финансирование: Эта работа финансировалась за счет гранта Европейского фонда сельскохозяйственных гарантий (797/2004). ВВП был поддержан стипендией Conventions Industrielles de Formation par la REcherche (ANRT). Финансирующие организации не играли никакой роли в дизайне исследования, сборе и анализе данных, принятии решения о публикации или подготовке рукописи.

Конкурирующие интересы: Авторы заявили, что никаких конкурирующих интересов не существует.

Введение

Обеспечивая воспроизводство многих растений, опылители, такие как медоносные пчелы, необходимы для функционирования природных и сельскохозяйственных экосистем [1–3]. В свою очередь, опылители извлекают выгоду из этой услуги по опылению, собирая питательные вещества (нектар и пыльца), необходимые для их роста и здоровья. Например, у медоносных пчел цветочный нектар, содержащий углеводы и хранящийся в виде меда, является энергетическим топливом людей, а пыльца обеспечивает большинство питательных веществ, необходимых для их физиологического развития [4].Таким образом, развитие и выживание семей медоносных пчел тесно связаны с доступностью этих питательных веществ в окружающей среде [4–6], что предполагает, что изменение районов кормления пчел из-за текущей интенсификации сельского хозяйства и изменений ландшафта может обеспечить недостаточное питание. и, следовательно, влияют на популяции медоносных пчел [7,8]. Это подтверждают и пчеловоды, которые считают плохое питание и голодание двумя основными причинами гибели колоний [9].Следовательно, изучение связи между доступностью питательных веществ и здоровьем пчел может помочь лучше понять текущие потери пчел, наблюдаемые во всем мире [10,11].

Среди этих питательных веществ для цветов пыльца, которая фактически является основным источником белков, аминокислот, липидов, крахмала, стеролов, витаминов и минералов [12,13], является основным фактором, влияющим на продолжительность жизни людей [6]. Пыльца также важна на уровне колонии, поскольку она позволяет молодым рабочим производить студень, который используется для кормления личинок, маток, трутней и пожилых рабочих [14,15].Следовательно, прямым следствием недостаточности питания (нехватки пыльцы) является уменьшение популяции колонии [5] и, вероятно, ухудшение здоровья отдельных особей, что также может повлиять на порог устойчивости пчел к другим стрессам (патогенам или пестицидам) [8, 16]. Действительно, известно, что потребление пыльцы влияет на физиологический метаболизм [17,18], иммунитет [19], устойчивость к патогенам, таким как бактерии [20], вирус [21] и микроспоридии [22], а также снижает чувствительность к пестицидам [23]. .Однако медоносные пчелы редко сталкиваются с полным отсутствием пыльцы в окружающей их среде, а скорее сталкиваются с изменчивостью во времени и пространстве изобилия, типа и разнообразия ресурсов пыльцы. Кроме того, пыльца может различаться между видами цветов в отношении содержания питательных веществ [24–26], что позволяет предположить, что некоторые из них более полезны для пчел, чем другие. Следовательно, изучение влияния потребления пыльцы на здоровье пчел требует также учета качества и разнообразия пыльцевых рационов. Несмотря на то, что некоторые исследования показали, что качество пыльцы может влиять на продолжительность жизни пчел [27–30] и развитие гипофарингеальных желез [29,31], а в последнее время разнообразие пыльцы может улучшить некоторые иммунные функции [19], наши знания о влиянии Качество и разнообразие пыльцевых диет на здоровье пчел весьма ограничены.

Чтобы улучшить наши знания по этой теме, было исследовано влияние качества и разнообразия пыльцевого рациона на физиологию медсестер и устойчивость к паразитам. Поскольку пыльца в основном потребляется молодыми пчелами-кормилицами, у них очень специфическая физиология питания с большими запасами липидов и белков (см. Обзоры в 32,33). Примечательно, что потребление пыльцы способствует развитию их гипофарингеальных желез, где переваренные питательные вещества пыльцы используются для производства студня, белкового секрета желез, который есть у сокамерников [14,15].Таким образом, физиология пчел-медсестер оценивалась путем определения развития гипофарингеальных желез, а также уровня экспрессии гена вителлогенина , который высоко экспрессируется у медсестер по сравнению с собирателями [34] и кодирует основной белок, продуцируемый в жировом теле и используется для производства студня [35]. Этот ген, который может регулироваться питанием [17,18], также замедляет старение [36] и участвует в регуляции клеточных иммунных функций [37]. Мы включили анализ гена трансферрина , белка транспорта железа, также продуцируемого в жировом теле и участвующего в развитии яичников [38-40] и иммунном ответе [41], как и вителлогенин .Однако неизвестно, регулируется ли он с точки зрения питания, что будет проверено в ходе этого исследования. Наконец, устойчивость к паразитизму была проверена с использованием широко распространенной микроспоридии Nosema ceranae , кишечного паразита, который может играть роль в потере колоний или ослаблении медоносных пчел [42–45]. С этой целью мы оценили влияние пыльцевой диеты и паразитов на выживаемость пчел и на физиологию путем измерения активности глутатион-S-трансферазы (GST), фенолоксидазы (PO) и щелочной фосфатазы (ALP).GST играют важную роль в детоксикации эндогенных и экзогенных соединений [46] и могут индуцироваться в кишечнике насекомых после бактериальной инфекции, что свидетельствует о защитной роли против патогенов [47]. Кроме того, предыдущие исследования показали более высокую активность GST после инфекции Nosema у пчел [48,49]. ПО играет важную роль в иммунитете насекомых, инкапсулируя патогены (например, бактерии и грибки) и восстанавливая ткани посредством меланогенеза [50], а ЩФ, участвующая во многих метаболических процессах, высоко экспрессируется в кишечнике насекомых и играет ключевую роль в здоровье кишечника у них. млекопитающие [51].

Материалы и методы

Состав пыльцы и факторы питания

Влияние качества и разнообразия пыльцы было проверено путем кормления пчел монофлорными рационами, которые различались по питательным свойствам, или полифлерным рационом, состоящим из разных монофлорных пыльцевых пыльцев. Четыре смеси пыльцы диких цветов с преобладанием пыльцы Cistus, Erica, Castanea и Rubus были приобретены свежими у Pollenergie® (Франция) и хранили при -20 ° C.Гранулы пыльцы собирали из пыльцевых ловушек у входа в улей. Рационы монофлорной пыльцы Cistus, Erica, Castanea и Rubus получали путем сортировки по цвету гранул преобладающей пыльцы из каждой смеси. Затем были проведены палинологические тесты для подтверждения рода каждой отсортированной пыльцы. Рацион полифлерной пыльцы состоял из смеси четырех монофлоральных пыльцевых частиц (25% каждой в зависимости от их веса).

Чтобы оценить питательную ценность каждой диеты с пыльцой, мы проанализировали их содержание белка, аминокислот, липидов и сахара, а также их антиоксидантную способность. Содержание белка определяли микрокьельдалевым анализом (N x 6,25) с использованием Vapodest 45 (Gerhardt) и в соответствии с процедурой ISO 5983-2 [52]. Общие липиды анализировали после разрушения стенки пыльцы с помощью кислотного гидролиза соляной кислотой (HCl 6N). Затем липиды экстрагировали смесью хлороформ / метанол (2: 1, об. / Об.) По методу Folch et al. [53]. Содержание белка и липидов выражали в процентах от сухого вещества, которое определяли после сушки пыльцы в течение 24 ч при 75 ° C [54].Природу и концентрацию аминокислот определяли в 20 мг пыльцы методом ионообменной хроматографии с использованием автоматического анализатора аминокислот в соответствии с процедурой EC 152/2009 [55]. Использовали метод поглощения радикалов кислорода (ORAC) с AAPH (2,2’-азобис (2-амидинопропан) дигидрохлорид) в качестве генератора свободных радикалов, как описано Ou et al. [56], чтобы измерить антиоксидантную способность в 1 г каждой пыльцы. Антиоксидант тролокс использовался в качестве стандарта, поэтому данные выражены в эквиваленте тролокса. Для качественного измерения содержания сахара пыльцу обезвоживали в течение 48 часов при 35 ° C. Взвешивали 30 мг пыльцы и добавляли 1000 мкл воды сверхвысокого качества (18,2 мОм). Содержимое пропускали шприцем Hamilton через фильтр 0,2 мкм (Millex LG CI, 0,2 мкм; Millipore) и вводили в оборудование HPAEC Dionex ICS-3000. Разделение углеводов проводили на защитной колонке CarboPac PA-1 (4 x 50 мм) и анионообменной колонке CarboPac PA-1 (4 x 250 мм) после двукратного разбавления.Количественное определение углеводов проводили методом импульсной амперометрической детекции [57]. Присутствие остатков пестицидов в различных диетах пыльцы оценивали с помощью газовой и жидкостной хроматографии с пределом количественного определения 0,01 мг / кг и пределом обнаружения 0,005 мг / кг в соответствии с процедурой AFNOR 15662 [58] (Список проанализированных пестицидов в таблице S1).

Выращивание и кормление пчел

Для контроля поступления пыльцы эксперименты проводили на однодневных пчелах ( Apis mellifera ), выращиваемых в клетках (10. 5 см x 7,5 см x 11,5 см). Соответствующие по возрасту пчелы были получены путем помещения сот, содержащих куколки на поздней стадии, в инкубатор при 34 ° C и 50-70% влажности и сбора пчел, появившихся в течение 10 часов. Они произошли из трех колоний и были смешаны перед помещением в клетки. Пчелам в клетках, содержащихся в инкубаторе (34 ° C и 50-70% влажности), давали ad libitum леденцы (Apifonda + сахарная пудра) и вода. Группы пчел скармливались одним из следующих рационов с монофлорной пыльцой: Erica, Cistus, Rubus или Castanea , смесь четырех пыльцы (полифлорный рацион) или не получали никакой пыльцы.Пыльцевые рационы готовили путем смешивания пыльцы с водой при массовом соотношении 10/1 (пыльца / вода), свежеприготовленные и заменяли каждый день в течение 7 дней. Чтобы предотвратить потенциальную компенсацию питательной ценности пчел, получавших одну из пыльцевых диет, им не давали пыльцу ad libitum , а получали определенное количество пыльцы каждый день: 4 мг / пчела в первые два дня, 5 мг / пчела в следующие. два дня, 3 мг на пчелу на пятый день и 2 мг на пчелу в последние два дня. Эти количества были определены посредством предварительных экспериментов и представляют собой минимальное потребление всех пыльцы в день; и, как было обнаружено ранее, потребление пыльцы меняется с возрастом пчел (в первые дни увеличивается, а затем уменьшается) [4,31].Используя этот метод, пчелам давали одинаковое количество пыльцы для каждого рациона, и они потребляли все это каждый день. Поскольку некоторые пчелы погибли во время периода кормления пыльцой (7 дней), количество пыльцы корректировалось каждый день в соответствии с количеством выживших пчел.

Влияние качества и разнообразия пыльцы на физиологию медсестры

Группы из 35 однодневных пчел были помещены в клетки и выращены в течение 7 дней с одной пыльцевой диетой. На 8 день их мгновенно замораживали в жидком азоте и хранили при -80 ° C для последующих физиологических анализов.Эксперимент повторяли 14 раз за один прием пыльцы.

Развитие гипофарингеальных желез.

Правая и левая железы в форме пяти пчел на клетку вскрывали на льду в 100 мкл физиологической сыворотки (0,9% NaCl). Обе железы были установлены на предметных стеклах и проанализированы под оптическим микроскопом, соединенным с камерой CF 11 DSP (Kappa). Развитие железы оценивали путем измерения максимального диаметра 15 случайно выбранных ацинусов на каждую железу ( n = 30 ацинусов на пчелу) [59] с помощью Saisam 5.Программное обеспечение 0.1 (Microvision®).

Экспрессия гена брюшной полости.

Брюшки 10 пчел на клетку гомогенизировали в 1 мл реагента Trizol (Invitrogen®) с TissueLyser (Qiagen®) (4 x 30 с при 30 Гц). Смесь инкубировали 5 мин при комнатной температуре и после центрифугирования (12000 g в течение 30 с при 4 ° C) 500 мкл супернатанта использовали для экстракции РНК. Добавляли сто мкл хлороформа (Sigma®), раствор инкубировали в течение 3 минут и центрифугировали (12000 g в течение 15 минут при 4 ° C).Водную фазу смешивали с равным объемом 70% этанола (Sigma®) и переносили в колонку Qiagen RNeasy. Экстракцию РНК проводили, как указано в наборе Qiagen RNeasy для общей РНК, с обработкой ДНКазой I на колонке (Qiagen®). Для синтеза кДНК 1000 нг РНК на образец подвергали обратной транскрипции с использованием набора High capacity RNA to cDNA Kit (Applied Biosystems). Образцы кДНК разводили в десять раз водой молекулярной чистоты.

Уровень экспрессии вителлогенина и трансферрина определяли количественной ПЦР с использованием систем ПЦР в реальном времени StepOne-Plus (Applied Biosystems®) и метода обнаружения зеленого SYBR, включая пассивный эталонный краситель ROX.Три мкл кДНК смешивали с 5 мкл основной смеси SYBR Green PCR (Applied Biosystems®), 1 мкл прямого праймера (10 мкмоль) и 1 мкл обратного праймера (10 мкмоль) генов-кандидатов. Значения порога цикла (Ct) выбранных генов были нормализованы к гену домашнего хозяйства Actin с использованием метода сравнительной количественной оценки (метод дельта Ct). Последовательности праймеров (5’ – 3 ’) были: вителлогенин, вперед: TTGACCAAGACAAGCGGAACT, наоборот: AAGGTTCGAATTAACGATGAA [60]; ген трансферрина : прямой: AGCGGCATACTCCAGGGAC, обратный: CGTTGAGCCTGATCCATACGA [61]; Актин вперед: TGCCAACACTGTCCTTTCTG, назад: AGAATTGACCCACCAATCCA.

Влияние качества и разнообразия пыльцы на устойчивость пчел к

Nosema ceranae

Для эксперимента по толерантности пчел к Nosema ceranae , группы из 70 однодневных пчел были помещены в клетки и выращены в течение 7 дней с одной пыльцевой диетой. Для каждой диеты с пыльцой одна группа была инфицирована Nosema , а одна группа — Nosema -free, что дало 12 групп лечения. На 10 день 28 пчел на клетку мгновенно замораживали в жидком азоте и хранили при -20 ° C до анализа на глутатион-S-трансферазу, щелочную фосфатазу и фенолоксидазу.Остальные 42 пчелы были использованы для определения влияния пыльцевой диеты и Nosema ceranae на выживаемость пчел. Ежедневно подсчитывали мертвых пчел и удаляли их из клеток до тех пор, пока половина пчел не погибла. Эксперимент повторяли 9 раз для каждой группы лечения (пыльцевая диета, инфекция Nosema ).

Заражение пчел
Nosema ceranae .

Споры Nosema были выделены из инфицированных колоний. Десять брюшков пчел-собирателей измельчали ​​в 2 мкл дистиллированной воды с помощью электрического измельчителя (Ultra Turrax® T18 basic, IKA®).Затем гомогенаты фильтровали через бумажный ватман № 4 и в фильтрат добавляли 10 мл дистиллированной воды. Растворы центрифугировали три раза при 800 g в течение 6 минут, и каждый раз осадок спор ресуспендировали в 10 мл дистиллированной воды. Идентификацию видов проводили, как в Alaux et al. [62], а концентрацию спор определяли с помощью гемоцитометра. Чтобы одинаково заразить пчел инокулятом Nosema ceranae , пчелам по отдельности скармливали 2 мкл свежеприготовленного 50% раствора сахарозы, содержащего 100 000 спор, который, как известно, вызывает инфекцию у рабочих пчел [63–65].Контрольных пчел кормили раствором сахарозы. В конце эксперимента кишечник пчел был проанализирован: у контрольных пчел споры обнаружены не были, но инфицированные пчелы были сильно паразитированы (данные не показаны).

Ферментный анализ.

Активность ферментов исследовали в различных тканях пчел: GST в кишечнике и голове, ALP в кишечнике и PO в брюшной полости без кишечника. Все анализы были выполнены на 3 пулах по 3 пчелы в клетке и в трех экземплярах. Образцы гомогенизировали при 4 ° C с помощью TissueLyser (Qiagen®) (5 × 10 с при 30 Гц) в буфере для экстракции (10 мМ NaCl, 1% (мас. / Об.) Triton X-100, 40 мМ фосфат натрия, pH 7.4, содержащий смесь 2 мг / мл антипаина, лейпептина и пепстатина А, 25 единиц / мл апротинина и 0,1 мг / мл ингибитора трипсина) в расчете на массу каждого пула (10% мас. / Об. Экстракта). Затем гомогенат центрифугировали при 4 ° C в течение 20 мин при 15000 g. Ферментативную активность в супернатанте анализировали в микропланшетах с помощью спектрофотометра BioTek Synergy HT100 (BioTek Instruments®). GST анализировали в реакционной среде (конечный объем 200 мкл), содержащей 10 мкл тканевого экстракта и 1 мМ EDTA, 2.5 мМ восстановленный глутатион, 1 мМ 1-хлор-2,4-динитробензол и 100 мМ Na / K-фосфат, pH 7,4. Активность GST отслеживали спектрофотометрически при 340 нм путем измерения конъюгации 1-хлор-2,4-динитробензола с восстановленным глутатионом в течение 5 минут при 25 ° C. ALP анализировали в реакционной среде (конечный объем 200 мкл), содержащей 10 мкл тканевый экстракт и 20 мМ MgCl 2 , 2 мМ p -нитрофенилфосфата в качестве субстрата и 100 мМ трис-HCl pH 8,5 [66]. Активность ALP отслеживали путем измерения гидролиза p -нитрофенилфосфата при 410 нм в течение 5 минут при 25 ° C.PO анализировали в реакционной среде (конечный объем 200 мкл), содержащей 50 мкл тканевого экстракта и 200 мМ NaCl, 0,4 мг / мл L-Dopa (3,4-дигидрокси-L-фенилаланин), 100 мМ фосфата натрия, pH. 7.2). Активность ПО отслеживали при 490 нм, измеряя превращение L-Dopa в меланин в течение 10 мин [62].

Статистический анализ.

Статистический анализ проводился с использованием статистической программы R [67]. Поскольку данные не были нормально распределены, влияние качества и разнообразия пыльцы на развитие гипофарингеальной железы, экспрессию вителлогенина и трансферрина и ферментативную активность было проанализировано с использованием множественных сравнительных тестов Краскела-Уоллиса и Данна. Для анализа данных о выживаемости, полученных в течение 50 дней эксперимента, мы преобразовали данные в таблице выживаемости, и оставшиеся пчелы считались живыми на 50-й день. Следовательно, мы использовали регрессионную модель пропорциональных рисков Кокса с функциями R (coxph) и пакет [выживание] [68] для анализа влияния взаимодействия Nosema , пыльцы и пыльцы Nosema x на выживаемость пчел. Затем были протестированы эффекты Nosema для каждой пыльцевой диеты и влияние каждой пыльцы у непаразитированных пчел и у Nosema пчел на выживаемость.Для пчел, не зараженных паразитами и Nosema , влияние рациона пыльцы на ферментативную активность определяли с помощью множественных сравнительных тестов Краскела-Уоллиса и Данна. Для каждой пыльцевой диеты влияние паразитизма Nosema на активность ферментов анализировали с использованием U-теста Манна-Уитни. Наконец, чтобы лучше понять основные механизмы долголетия пчел, мы оценили связь между LT50 (день, когда 50% пчел умерли в каждой клетке на основе необработанных данных) и активностью ферментов (среднее значение из 3 проанализированных бассейнов на клетку) с использованием корреляции Спирмена для здоровых и паразитированных пчел.

Результаты

Факторы питания пыльцевой диеты

Пищевая ценность каждой пыльцы была определена перед тестированием их воздействия на пчел (Таблица 1). Мы не обнаружили присутствие пестицидов в четырех пыльцах, входящих в состав различных рационов (Таблица S1). В отличие от липидов и сахаров, уровни белков, аминокислот и антиоксидантная способность сильно различались между пыльцой. Таким образом, пыльцевые рационы можно классифицировать по содержанию белка следующим образом (от самых бедных до самых богатых): Cistus , Erica , Mix (25% каждой пыльцы), Castanea и Rubus .Точно такая же тенденция была обнаружена при рассмотрении уровней аминокислот и антиоксидантов. Разница между Cistus и Rubus была особенно разительной: последний имел примерно в два раза больше белков и аминокислот и почти в пять раз большую антиоксидантную способность. Однако содержание липидов и сахара, которые не сильно различались, следовало разным образцам. Например, пыльца Erica была самой богатой липидами, но самой бедной по сахарам, и наоборот, пыльца Rubus .

мкмоль 39
Пыльца Белки (%) Липиды (%) Сахара (%) Аминокислоты (г) Антиоксиданты
Cistus 12 6,9 5,2 11,9 103
Erica 14,8 7,4 4,8 16. 27 196
Castanea 21,6 6,6 5,0 18,68 399
Рубус 22 6,4 47 900 900 43 900 900 900 9 900 43
Mix 17,6 6,8 5,4 16,71 293

Таблица 1. Содержание питательных факторов в различных пыльцах

диет .

Все корма из пыльцы содержали одни и те же аминокислоты, включая 10 незаменимых аминокислот, необходимых для развития взрослых пчел [69]: аргинин, гистидин, лизин, триптофан, фенилаланин, метионин, треонин, лейцин, изолейцин и валин (Таблица S2). Что касается содержания белка, большинство аминокислот было в меньших количествах в пыльце Cistus (особенно в 10 незаменимых аминокислотах) и в больших количествах в пыльце Rubus , тогда как пыльца Erica и Castanea имела промежуточные уровни.Только пролин был в максимальном количестве в пыльце Cistus .

Что касается отдельных сахаров, во всех пыльцах были обнаружены только глюкоза и фруктоза (Таблица S3). Трегалоза, основной сахар гемолимфы пчел, присутствовала в пыльце Cistus и Castanea . Наконец, эрлоза была обнаружена только в пыльце Castanea, которая содержала все проанализированные сахара.

Влияние качества и разнообразия пыльцы на физиологию пчел-кормилиц

Пыльца изменила развитие гипофарингеальных желез (тест Краскела-Уоллиса, H = 143.84, p <0,001; Рисунок 1A), который был снижен у пчел, выращенных без пыльцы, но варьировался в зависимости от качества пыльцы, поскольку ацинусы были более развиты у пчел, получавших пыльцу Rubus , по сравнению с пчелами, получавшими пыльцу Cistus и Erica (Рисунок 1A). Развитие желез у пчел, получавших полифлерную смесь, не отличалось от пчел, получавших монофлерный рацион (139,5 ± 2,3 мкм), но почти равнялось среднему развитию желез, вызванному четырьмя рационами (137.5 ± 4,1 мкм).

Рис. 1. Влияние качества и разнообразия пыльцы на физиологию медсестры.

(A) Размер ацинусов гипофарингеальной железы, (B) уровни экспрессии вителлогенина и (C) тансферрина . Коробчатые диаграммы показаны для 5 и 10 пчел / повторность для желез и каждого гена, соответственно ( n = 14 повторностей, дающих рацион 70 и 140 пчел / пыльцу для желез и каждого гена, соответственно). Разные буквы указывают на существенные различия между диетами пыльцы ( p <0.05, множественные сравнительные тесты Краскела-Уоллиса и Данна). Прямоугольники показывают 1-й и 3-й межквартильный размах с линией, обозначающей медиану. Усы охватывают 90% особей, за пределами которых все выбросы представлены кружками.

https://doi. org/10.1371/journal.pone.0072016.g001

На уровень экспрессии вителлогенина и трансферрина значительно влияли различные рационы пыльцы ( вителлогенин : тест Крускала-Уоллиса, H = 43.13, p <0,001, фиг. 1B; трансферрин : тест Крускала-Уоллиса, H = 42,31, p <0,001, рисунок 1C), с более высокой экспрессией у пчел, которых кормили пыльцой, чем у пчел, которые не получали пыльцу (рисунок 1C). Интересно, что качество пыльцевой диеты также повлияло на экспрессию обоих генов, поскольку пыльца Erica и Rubus запускала наивысшую экспрессию вителлогенина и трансферрина (рис. 1B и C).Влияние полифлерной диеты не отличалось от влияния других диет ( вителлогенин, : 4,8 ± 0,3 и трансферрин, : 2,4 ± 0,3) и соответствовало среднему уровню экспрессии генов, индуцированному четырьмя монофлорными диетами ( вителлогенин : 4,6 ± 0,5 и трансферрин : 2,4 ± 0,5).

Влияние качества и разнообразия пыльцы на устойчивость пчел к

Nosema ceranae

Nosema паразитизм и питание пыльцой уменьшали и увеличивали выживаемость пчел, соответственно (модель Кокса, p <0.001 для каждого фактора, рисунок 2). Эффект Nosema наблюдался независимо от типа рациона с пыльцой ( p <0,001 для каждого рациона с пыльцой, рисунок 2), и рационы с пыльцой изменяли выживаемость пчел независимо от воздействия Nosema (рисунок 2 и таблица 2) . Однако мы обнаружили значительную взаимосвязь между рационом Nosema и пыльцевой диетой ( p <0,001, рис. 2). За исключением пыльцы Cistus , качество и разнообразие пыльцевого рациона не влияло на выживаемость здоровых пчел, но имело значение, когда пчелы были заражены паразитами (Рисунок 2 и Таблица 2).Действительно, мы наблюдали значительное иерархическое влияние монофлерной пыльцы на выживаемость паразитированных пчел в следующем порядке от наименее полезной пыльцы к наиболее полезной: Cistus < Castanea < Erica < Rubus . Кроме того, пчелы, получавшие смесь полифлорной пыльцы, жили значительно дольше, чем пчелы, получавшие пыльцу Cistus , Erica и Castanea , но не было значительных различий с пчелами, получавшими пыльцу Rubus (Рисунок 2 и Таблица 2). .

Рис. 2. Влияние пыльцевой диеты и инфекции Nosema ceranae на выживаемость пчел.

Данные показывают процент выживаемости в течение 50 дней для (А) непаразитированных и (В) Nosema -паразитизированных пчел (9 повторов на пыльцевую диету). Разные буквы обозначают существенные различия между рационами пыльцы у непаразитированных или паразитизированных Nosema пчел ( p <0,05, модель регрессии пропорциональных рисков Кокса).

https: // doi.org / 10.1371 / journal.pone.0072016.g002

900 пыльца. 0001
Cistus Erica

1

9049 Castanea 900 41
A
Без пыльцы <0,0001 <0,0001 <0,0001 <0,0001 <0. 0001
Cistus <0,0001 <0,0001 <0,0001 <0,0001
Erica 0,47 9004 0,47 0,36 0,84
Rubus 0,47
B
<0,0001 <0,0001 <0,0001 <0,0001
Cistus <0,0001 <0,0001 <0,0001 <0,0001 900 900 <0,0001 0,047 0,007
Castanea <0,0001 <0,0001
Rubus 42

Таблица 2. Сравнительные эффекты пыльцевых рационов на выживаемость (A) непаразитированных пчел и (B) Nosema -паразитизированных пчел.

Если посмотреть на физиологию пчел, Nosema не влияет на активность GST в кишечнике (рис. 3А). Тем не менее, пыльцевой рацион изменил уровень GST как у здоровых, так и у паразитированных пчел (тест Краскала-Уоллиса, H = 35,73, p <0,001 и тест Краскела-Уоллиса, H = 32,73, p <0.001, соответственно, фиг. 3A), а самая высокая активность наблюдалась с пыльцевой диетой Erica (фиг. 3A). В голове активность GST была значительно ниже у пчел, инфицированных Nosema (рис. 3B), но была выше у пчел, которых кормили пыльцой, независимо от воздействия Nosema (тест Краскела-Уоллиса, H = 22,06, p ). <0,001 и критерий Краскела-Уоллиса, H = 27,28, p <0,001, соответственно, рисунок 3B). В отличие от того, что наблюдалось в кишечнике, тип пыльцевой диеты не влиял на уровень GST в голове.

Рис. 3. Влияние пыльцевой диеты и инфекции Nosema ceranae на глутатион-S-трансферазу.

Активность фермента оценивали в (A) кишечнике и (B) головах пчел. Коробчатые диаграммы показаны для 3 пулов по 3 пчелы / повтор ( n = 9 повторностей, что дает 81 пчелу всего / рацион пыльцы). Разные буквы обозначают значительные различия между рационами пыльцы у непаразитированных (белые прямоугольники) или Nosema -паразитизированных пчел (серые прямоугольники) ( p <0.05, множественные сравнительные тесты Краскела-Уоллиса и Данна) и * указывают на значительные различия между паразитированными и непаразитированными пчелами для каждой пыльцевой диеты ( p <0,05, U-критерий Манна-Уитни). Прямоугольники показывают 1-й и 3-й межквартильный размах с линией, обозначающей медиану. Усы охватывают 90% особей, за пределами которых все выбросы представлены кружками.

https://doi.org/10.1371/journal.pone.0072016.g003

Nosema ceranae вызывало снижение активности ЩФ независимо от рациона пыльцы (рис. 4).Однако, помимо более высокой активности, индуцированной пыльцой Castanea по сравнению с пыльцой Cistus у здоровых пчел, качество и разнообразие поставляемой пыльцы не влияли на активность ЩФ в кишечнике пчел (здоровые пчелы: тест Краскела-Уоллиса, H = 14,29, p = 0,013 и паразитированные пчелы: тест Крускала-Уоллиса, H = 12,54, p = 0,028, рисунок 4).

Рисунок 4. Влияние пыльцевой диеты и инфекции Nosema ceranae на щелочную фосфатазу кишечника.

Коробчатые диаграммы показаны для 3 пулов по 3 пчелы / повторность ( n = 9 повторностей, что дает 81 пчелу всего / рацион пыльцы). Разные буквы обозначают существенные различия между диетами пыльцы у непаразитизированных (белые прямоугольники) или Nosema -паразитизированных пчел (серые прямоугольники) ( p <0,05, множественные сравнительные тесты Краскела-Уоллиса и Данна), а * указывает на значимые различия между паразитированными и непаразитированными пчелами для каждой пыльцевой диеты ( p <0. 05, U-тесты Манна-Уитни). Прямоугольники показывают 1-й и 3-й межквартильный размах с линией, обозначающей медиану. Усы охватывают 90% особей, за пределами которых все выбросы представлены кружками.

https://doi.org/10.1371/journal.pone.0072016.g004

Nosema ceranae вызвала значительное повышение активности ПО у пчел, лишенных пыльцы (Рисунок 5). У инфицированных пчел активность иммунных ферментов была ниже в присутствии пыльцы, за исключением Эрики (тест Краскела-Уоллиса, H = 49.64, p <0,001, рисунок 5). У здоровых пчел потребление пыльцы имело ограниченное влияние на активность ПО (тест Краскала-Уоллиса, H = 19,24, p <0,001, рис. 5). Только пыльца Erica показала значительно более высокую активность по сравнению с пыльцой Castanea и Rubus .

Рис. 5. Влияние пыльцевой диеты и инфекции Nosema ceranae на фенолоксидазу.

Коробчатые диаграммы показаны для 3 пулов по 3 пчелы / повторность ( n = 9 повторностей, что дает 81 пчелу всего / рацион пыльцы). Разные буквы обозначают существенные различия между диетами пыльцы у непаразитизированных (белые прямоугольники) или Nosema -паразитизированных пчел (серые прямоугольники) ( p <0,05, множественные сравнительные тесты Краскела-Уоллиса и Данна), а * указывает на значимые различия между паразитированными и непаразитированными пчелами для каждой пыльцевой диеты ( p <0,05, U-критерий Манна-Уитни). Прямоугольники показывают 1-й и 3-й межквартильный размах с линией, обозначающей медиану. Усы охватывают 90% особей, за пределами которых все выбросы представлены кружками.

https://doi.org/10.1371/journal.pone.0072016.g005

Наконец, мы определили, связан ли LT50 пчел с активностью различных исследованных ферментов. У здоровых пчел продолжительность жизни положительно коррелировала с активностью ЩФ (т.е.активность ЩФ объясняла 50% продолжительности жизни пчел), но когда пчелы были инфицированы Nosema , продолжительность жизни была положительно связана с активностью ПО (Рисунок 6).

Обсуждение

Результаты этого исследования подтверждают идею о том, что питательные качества и разнообразие кормовой пыльцы могут влиять на здоровье пчел.В самом деле, мы обнаружили, что и физиология пчел, и толерантность к паразитам варьировались в зависимости от типа пыльцевого рациона, предполагая, что имеет значение не только доступность, но и качество ресурсов окружающей среды.

Тип пыльцы, которую давали пчелам, оказал значительное влияние на физиологию пчел-кормилиц. Пчелы, которых кормили пыльцой, богатой белком ( Rubus ), показали наиболее развитые ацинусы и самый высокий уровень экспрессии вителлогенина и трансферрина .Это имеет тенденцию подтверждать предыдущие исследования, которые показали, что развитие гипофарингеальной железы связано с уровнем белков в пище [29,31]. Однако другие рационы с пыльцой не вызывали значительного развития различных желез, что можно объяснить слишком маленьким диапазоном содержания белка и / или других факторов питания. Пыльца также увеличивала экспрессию вителлогенина и трансферрина . Поскольку оба гена экспрессируются в жировых телах, основном месте хранения питательных веществ, а пыльца способствует развитию жировых тел [19], разумно ожидать увеличения уровней экспрессии обоих генов, как было ранее обнаружено для вителлогенина после потребление белков [70].Однако экспрессия вителлогенина и трансферрина у пчел, получавших пыльцу Erica , не отличалась от пчел, получавших пыльцу Rubus , хотя Erica содержал меньшее количество белков. Это говорит о том, что их экспрессия чувствительна не только к уровню белка, но и к другим факторам питания. При рассмотрении факторов питания мы обнаружили, что пыльца Erica имеет самое высокое содержание липидов, что могло способствовать увеличению жировых тел и, следовательно, экспрессии обоих генов, поскольку жировые ткани также являются основным местом метаболизма липидов. (е. грамм. синтез жирных кислот и производство триацилглицеридов) [71]. Эта потенциальная роль липидов в синтезе вителлогенина дополнительно подтверждает, что они важны для физиологии медсестры [72] и производства расплода [73]. Кроме того, интересно отметить, что вителлогенин и трансферрин имели сходные паттерны экспрессии в соответствии с различными диетами пыльцы. Эта ковариация в экспрессии генов была также обнаружена в предыдущих работах по изучению потенциальной роли этих генов в развитии яичников [38,39].

Качество пыльцы также влияет на устойчивость пчел к паразитам ( Nosema ceranae ). Как и ожидалось, заражение Nosema уменьшило выживаемость пчел [49,64], а питание пыльцой увеличило выживаемость как здоровых, так и зараженных паразитами пчел. За исключением пчел, которых кормили пыльцой с бедным белком ( Cistus ), мы не наблюдали разницы в выживаемости между разными диетами пыльцы, когда пчелы не были паразитированы. Однако качество пыльцы имело сильное влияние, когда пчелы заражались микроспоридиями; выживаемость пчел значительно различалась между четырьмя различными монофлорными диетами (от наименее полезной пыльцы до наиболее полезной: Cistus < Castanea < Erica < Rubus ).Это говорит о том, что качество питательных веществ пыльцы может не иметь или иметь ограниченное влияние на физиологию здоровых пчел, но может повлиять на их способность переносить внешний стресс, такой как паразиты. Положительное влияние пыльцы Rubus по сравнению с пыльцой Cistus также было доказано при изучении влияния качества рациона на вес личинок шмелей [74]. Чрезвычайно высокий уровень белка и антиоксидантов пыльцы Rubus по сравнению с пыльцой Cistus может объяснить большую выживаемость инфицированных пчел, которых кормили пыльцой, полученной ранее.В частности, известно, что белки улучшают выживаемость пчел (см. 4 обзор). Высокий уровень аминокислот также может играть важную роль, поскольку десять из них необходимы пчелам в определенных концентрациях [69]. Однако иерархическое влияние монофлорной диеты не было связано с уровнями белков, аминокислот или антиоксидантов, например пчелы, получавшие пыльцу Erica (14,8% белка), жили дольше, чем пчелы, получавшие пыльцу Castanea (21,6% белка). Пыльца Erica фактически имела самое высокое содержание липидов и способствовала более высокому производству вителлогенина , чем пыльца Castanea (Рисунок 1B).Положительное влияние вителлогенина на продолжительность жизни пчел [36] может способствовать увеличению выживаемости паразитированных пчел, снабженных пыльцой Erica . Это говорит о том, что качество пыльцы следует оценивать не на основе одного или нескольких факторов питания, а на основе всех факторов питания в целом.

Что касается защитного механизма, общая активность GST (детоксикация), ALP и PO (иммунитет) также изменилась в соответствии с диетами пыльцы, но мы не наблюдали закономерности, аналогичной выживаемости пчел.Поэтому было невозможно связать влияние качества рациона на выживаемость пчел с уровнем активности этих ферментов. Более того, паттерны активности ферментов не были изменены инфекцией Nosema , но общий уровень головного GST и ALP был снижен, что подтверждает предыдущее исследование [49]. Однако ранее сообщалось о повышении активности GST в кишечнике Nosema -паразитированных пчел [48,49], что, вероятно, защищает хозяина от окислительного стресса, вызванного паразитом [47].Отсутствие ответа GST в нашем исследовании могло быть связано с диетой, поскольку мы не использовали коммерческую смесь белков, аминокислот и витаминов, как в обоих предыдущих исследованиях, что могло способствовать ответу GST. Интересно, что профиль активности GST в кишечнике был очень похож на профиль экспрессии вителлогенина и трансферрина в соответствии с различными диетами, причем пыльца Erica и Rubus давала наивысшую активность. Однако ничего не известно о связи между GST и этими двумя генами.Что касается активности ПО, то у других насекомых хорошо известно, что на уровень ПО может влиять качество рациона [75–77]. В самом деле, меланогенез, регулируемый ПО через синтез меланина (богатого азотом хинонового полимера), может быть дорогостоящим в азоте [78] и, таким образом, чувствителен к изменениям в ресурсах азота. Тем не менее, в предыдущем исследовании [19] он не отличался между диетами с пыльцой, а в нашем исследовании он был выше только с пыльцой Erica . Следовательно, необходимы дальнейшие исследования, чтобы лучше понять взаимосвязь между пыльцевым питанием и активностью ПО у пчел.

Диетическое разнообразие пыльцы не было связано с улучшением физиологии медсестер, что отражено измеренными физиологическими параметрами. Влияние полифлерной диеты фактически сводилось к среднему значению влияния каждой монофлорной пыльцы. Это говорит о том, что высококачественная монофлоральная пыльца может быть лучше, чем смесь более низкого питательного качества, как при выращивании расплода [79,80]. Однако вполне вероятно, что пыльцевый рацион пчел не влияет на различные физиологические факторы пчел в равной степени.Это наблюдалось в недавнем исследовании, показывающем более высокую активность глюкозооксидазы у пчел, которых кормили смесью полифлорной пыльцы, по сравнению с монофлорной пыльцой, но на активность ПО и количество гемоцитов полифлорная диета не влияла [19]. Это дополнительно подтверждается нашим исследованием, поскольку полифлоровая смесь положительно влияла на выживаемость паразитированных пчел. Он не соответствовал среднему значению для каждого эффекта пыльцы, но был выше, чем пыльца Cistus, Castanea и Erica , и на том же уровне, чем пыльца Rubus .Эта тенденция не наблюдалась у здоровых пчел, что еще раз указывает на то, что качество питания может значительно влиять на восприимчивость людей к паразитам. Неизвестно, было ли увеличение выживаемости пчел, которых кормили полифлорной смесью, результатом сочетания четырех пыльцы или простого присутствия пыльцы Rubus , хотя она содержала четверть этой пыльцы. Аналогичные результаты были получены Foley et al. [81], которые наблюдали снижение восприимчивости к грибковому паразиту Aspergillus личинок пчел, питавшихся определенной пыльцой или смесью.

Наконец, чтобы расшифровать некоторые физиологические механизмы, лежащие в основе здоровья пчел, мы определили, связана ли активность GST, PO и ALP с увеличением выживаемости у здоровых или паразитированных пчел. Выживание было положительно связано с активностью ALP и PO у здоровых и инфицированных Nosema пчел, соответственно. У млекопитающих ЩФ участвует в регуляции всасывания питательных веществ (особенно липидов), детоксикации бактериальных липополисахаридов, толерантности кишечника к комменсальным бактериям, предотвращает бактериальную инвазию и уменьшает воспаление кишечника, играя, таким образом, ключевую роль в здоровье кишечника (см. 51 обзор ).Неизвестно, выполняет ли ALP сходные роли у насекомых, но существуют структурные и функциональные гомологии между ALP насекомых и млекопитающих [82]. Кроме того, корреляция между активностью ЩФ и выживаемостью пчел предполагает, что этот фермент может иметь важное значение для здоровья насекомых. Когда его активность снизилась из-за инфекции Nosema , она больше не была связана с выживаемостью пчел. В этом случае выживаемость была связана с активностью ПО. Однако, за исключением отсутствия пыльцы, у паразитированных пчел не наблюдался иммунный ответ на ПО, что подтверждает идею о том, что выживаемость пчел просто связана с более высокой базальной активностью ПО.

В заключение следует отметить, что пыльца не имеет равных по своему влиянию на здоровье пчел, и полифлоровая смесь не обязательно лучше, чем монофлорная пыльца с хорошей питательной ценностью (например, пыльца Rubus ). Однако, когда пчелы заражены (по N . Ceranae здесь), доступность различных цветочных ресурсов может покрыть ограниченное влияние некоторых пыльцы и повысить устойчивость к инфекции до уровня богатой пыльцы. Ареалы опыления пчел в настоящее время меняются из-за интенсификации сельского хозяйства и изменения ландшафта, и пчелы часто сталкиваются с уменьшением доступности и разнообразия ресурсов во времени и пространстве.Ожидается, что глобальное изменение климата также изменит экологические ресурсы пчел из-за изменений в фенологии и распространении растений [83]. Следовательно, поддержание и / или развитие растительных ресурсов в агроэкосистемах необходимо для предотвращения негативного воздействия деятельности человека и поддержания популяции пчел [7].

Благодарности

Авторы хотели бы поблагодарить М. Кузена и Г. Роде за их помощь в вскрытии пчел, М. Шарбонье за ​​помощь с редактированием на английском языке и рецензентов за комментарии, которые значительно улучшили рукопись.

Вклад авторов

Задумал и спроектировал эксперименты: GDP YLC LPB AD CA. Проведены эксперименты: GDP MS SS CA. Проанализированы данные: ВВП АК JLB CA. Предоставленные реагенты / материалы / инструменты анализа: YLC LPB AD. Написал рукопись: GDP CA.

Ссылки

  1. 1. Klein AM, Vaissière BE, Cane JH, Steffan-Dewenter I, Cunningham SA et al. (2007) Важность опылителей в изменении ландшафтов мировых культур. Proc R Soc Lond B 274: 303-313.DOI: https: //doi.org/10.1098/rspb.2006.3721. PubMed: 17164193.
  2. 2. Gallai N, Salles JM, Settele J, Vaissiere BE (2009) Экономическая оценка уязвимости мирового сельского хозяйства в условиях сокращения количества опылителей. Ecol Econ 68: 810-821. DOI: https: //doi.org/10.1016/j.ecolecon.2008.06.014.
  3. 3. Морс Р.А. (1991) Пчелы навсегда. Тенденции Ecol Evol 6: 337-338. DOI: https: //doi.org/10.1016/0169-5347 (91)-W. PubMed: 21232501.
  4. 4. Brodschneider R, Crailsheim K (2010) Питание и здоровье медоносных пчел.Apidologie 41: 278-294. DOI: https://doi.org/10.1051/apido/2010012.
  5. 5. Келлер I, Флури П., Имдорф А. (2005) Питание пыльцой и развитие колоний у медоносных пчел, Часть II. Пчелиный мир 86: 27-34.
  6. 6. Хайдак М.Х. (1970) Медоносное питание пчел. Анну Преподобный Энтомол 15: 143-156. DOI: https: //doi.org/10.1146/annurev.en.15.010170.001043.
  7. 7. Decourtye A, Mader E, Desneux N (2010) Улучшение ландшафта цветочных ресурсов для медоносных пчел в агроэкосистемах.Apidologie 41: 264-277. DOI: https: //doi.org/10.1051/apido/2010024.
  8. 8. Науг Д. (2009) Стресс, связанный с питанием из-за потери среды обитания, может объяснить недавний коллапс пчелиной семьи. Биол Консерв 142: 2369-2372. DOI: https://doi.org/10.1016/j.biocon.2009.04.007.
  9. 9. Ван Энгельсдорп Д., Хейс мл., Андервуд Р. М., Петтис Дж. (2008) Обзор потерь колоний медоносных пчел в США с осени 2007 по весну 2008. PLOS ONE 3: e4071. DOI: https: //doi.org/10.1371/journal.pone.0004071.PubMed: 115.
  10. 10. Нойманн П., Каррек Н.Л. (2010) Потери пчелиных семей. J Apicult Res 49: 1-6. DOI: https: //doi.org/10.3896/IBRA.1.49.1.01.
  11. 11. Ван Энгельсдорп Д., Мейкснер М.Д. (2010) Исторический обзор управляемых популяций медоносных пчел в Европе и США и факторов, которые могут на них повлиять. J Invertebr Pathol 103: S80-S95. DOI: https: //doi.org/10.1016/j.jip.2009.06.011. PubMed: 193.
  12. 12. Roulston TH, Buchmann SL (2000) Филогенетический пересмотр корреляции пыльцевого крахмала и опыления.Evol Ecol Res 2: 627-643.
  13. 13. Стэнли Р.Г., Линскенс Х.Ф. (1974) Пыльца: биология, биохимия, менеджмент. Гейдельберг, Германия: Springer Verlag.
  14. 14. Crailsheim K, Schneider LHW, Hrassnigg N, Bühlmann G, Brosch U et al. (1992) Потребление и использование пыльцы рабочими пчелами (Apis mellifera carnica): зависимость от индивидуального возраста и функций. J. Insect Physiol 38: 409-419. DOI: https: //doi.org/10.1016/0022-1910 (92)
    -V.
  15. 15. Crailsheim K (1992) Поток студня в колонии медоносных пчел. J. Comp Physiol B 162: 681-689.DOI: https: //doi.org/10.1007/BF00301617.
  16. 16. Le Conte Y, Brunet J-L, McDonnell C, Dussaubat C, Alaux C (2011) Взаимодействие между факторами риска у медоносных пчел. В: D. SammataroJ. Йодер. Недавние исследования проблем с нашими опылителями меда пчелами. Taylor & Francis Inc., стр. 215–222.
  17. 17. Alaux C, Dantec C, Parrinello H, Le Conte Y (2011) Нутригеномика у медоносных пчел: цифровой анализ экспрессии генов питательных эффектов пыльцы на здоровых пчелах и пчелах, зараженных варроа.BMC Genomics 12: 496. DOI: https: //doi.org/10.1186/1471-2164-12-496. PubMed: 21985689.
  18. 18. Амент С.А., Чан К.В., Уиллер М.М., Никсон С.Е., Джонсон С.П. и др. (2011) Механизмы стабильной потери липидов у социальных насекомых. J Exp Biol 214: 3808-3821. DOI: https://doi.org/10.1242/jeb.060244. PubMed: 22031746.
  19. 19. Alaux C, Ducloz F, Crauser D, Le Conte Y (2010) Влияние диеты на иммунокомпетентность медоносных пчел. Biol Lett 6: 562-565. DOI: https: //doi.org/10.1098/rsbl.2009.0986. PubMed: 20089536.
  20. 20. Риндерер Т.Е., Ротенбюлер В.К., Гохнауэр Т.А. (1974) Влияние пыльцы на восприимчивость личинок медоносных пчел к личинкам Bacillus . J Invertebr Pathol 23: 347-350. DOI: https: //doi.org/10.1016/0022-2011 (74)
    -1. PubMed: 4833177.
  21. 21. Degrandi-Hoffman G, Chen Y, Huang E, Huang MH (2010) Влияние диеты на концентрацию белка, развитие гипофарингеальных желез и вирусную нагрузку у рабочих медоносных пчел ( Apis mellifera L.). J. Физиология насекомых 56: 1184-1191. DOI: https: //doi.org/10.1016/j.jinsphys.2010.03.017. PubMed: 20346950.
  22. 22. Риндерер Т.Э., Эллиотт К.Д. (1977) Реакция рабочих медоносных пчел на инфекцию Nosema apis . J Econ Entomol 70: 431-433.
  23. 23. Wahl O, Ulm K (1983) Влияние кормления пыльцой и физиологического состояния медоносной пчелы на пестициды Apis mellifera carnica . Oecologia 59: 106-128. DOI: https: //doi.org/10.1007/BF00388082.
  24. 24. Roulston TH, Cane JH (2000) Пищевая ценность и усвояемость пыльцы для животных. Plant Syst Evol 222: 187-209. DOI: https: //doi.org/10.1007/BF00984102.
  25. 25. Герберт Э. У. мл., Шимануки Х. (1978) Химический состав и питательная ценность пыльцы, собранной и хранимой пчелами. Апидология 9: 33-40. DOI: https: //doi.org/10.1051/apido: 19780103.
  26. 26. Odoux JF, Feuillet D, Aupinel P, Loublier Y, Tasei JN et al. (2012) Территориальное биоразнообразие и его влияние на физико-химические характеристики пыльцы, собираемой семьями медоносных пчел.Apidologie 43: 561-575. DOI: https: //doi.org/10.1007/s13592-012-0125-1.
  27. 27. Schmidt JO, Thoenes SC, Levin MD (1987) Выживание медоносных пчел, Apis mellifera (Hymenoptera: Apidae), питавшихся различными источниками пыльцы. J Econ Entomol 80: 176-183.
  28. 28. Schmidt LS, Schmidt JO, Rao H, Wang W, Xu L (1995) Предпочтение кормления и выживаемость молодых рабочих медоносных пчел (Hymenoptera: Apidae), которых кормили рапсом, кунжутом и пыльцой подсолнечника. J Econ Entomol 88: 1591-1595.
  29. 29. Standifer LN (1967) Сравнение качества белка пыльцы для стимуляции роста гипофарингеальных желез и долголетия медоносных пчел, Apis mellifera L. (Hymenoptera: Apidae). Насекомые Soc 14: 415-426. DOI: https: //doi.org/10.1007/BF02223687.
  30. 30. Маурицио А. (1950) Влияние кормления пыльцой и выращивания расплода на продолжительность жизни и физиологическое состояние медоносной пчелы. Пчелиный мир 31: 9-12.
  31. 31.Pernal SF, Currie RW (2000) Качество пыльцы свежих и однолетних рационов с одной пыльцой для рабочих медоносных пчел ( Apis mellifera L.). Apidologie 31: 387-409. DOI: https: //doi.org/10.1051/apido: 2000130.
  32. 32. Амдам Г. В., Пейдж RE (2010) Генетика развития и физиология пчелиных сообществ. Анимационное поведение 79: 973-980. DOI: https: //doi.org/10.1016/j.anbehav.2010.02.007. PubMed: 20514137.
  33. 33. Ament SA, Wang Y, Robinson GE (2010) Регулирование питания при разделении труда у медоносных пчел: к перспективе системной биологии.Wiley Interdiscip. Rev Syst Biol Med 2: 566-576.
  34. 34. Amdam GV, Norberg K, Fondrk MK, Page RE Jr. (2004) Репродуктивный план почвы может опосредовать эффекты отбора на уровне колонии на индивидуальное поведение медоносных пчел при кормлении. Proc Natl Acad Sci U S A 101: 11350-11355. DOI: https://doi.org/10.1073/pnas.0403073101. PubMed: 15277665.
  35. 35. Амдам Г. В., Норберг К., Хаген А., Омхольт С. В. (2003) Социальная эксплуатация вителлогенина. Proc Natl Acad Sci U S A 100: 1799–1802.DOI: https: //doi.org/10.1073/pnas.0333979100. PubMed: 12566563.
  36. 36. Seehuus SC, Norberg K, Gimsa U, Krekling T, Amdam GV (2006) Репродуктивный белок защищает функционально стерильных рабочих медоносных пчел от окислительного стресса. Proc Natl Acad Sci U S A 103: 962-967. DOI: https: //doi.org/10.1073/pnas.0502681103. PubMed: 16418279.
  37. 37. Амдам Г. В., Симоэс ЗЛП, Хаген А., Норберг К., Шредер К. и др. (2004) Гормональный контроль предшественника желтка, вителлогенина, регулирует иммунную функцию и продолжительность жизни медоносных пчел.Эксп. Геронтол 39: 767-773. DOI: https: //doi.org/10.1016/j.exger.2004.02.010. PubMed: 15130671.
  38. 38. Koywiwattrakul P, Sittipraneed S (2009) Экспрессия вителлогенина и трансферрина в активированных яичниках рабочих медоносных пчел, Apis mellifera . Biochem Genet 47: 19-26. DOI: https: //doi.org/10.1007/s10528-008-9202-6. PubMed: 128.
  39. 39. Koywiwattrakul P, Thompson GJ, Sitthipraneed S, Oldroyd BP, Maleszka R (2005) Влияние наркоза углекислым газом на активацию яичников и экспрессию генов у рабочих медоносных пчел, Apis mellifera .J Insect Sci 5: 36. PubMed: 17119618.
  40. 40. Нино Е.Л., Тарпи Д.Р., Грозингер С.М. (2013) Дифференциальное влияние объема осеменения и вещества на репродуктивные изменения маток медоносных пчел ( Apis mellifera L.). Насекомое Mol Biol.
  41. 41. Kucharski R, Maleszka R (2003) Транскрипционное профилирование выявляет многофункциональные роли трансферрина у медоносной пчелы, Apis mellifera . J Insect Sci 3: 27. PubMed: 15841243.
  42. 42. Хигес М., Меана А., Бартоломе С., Ботиас С., Мартин-Эрнандес Р. (2013) Nosema ceranae (Microsporidia), спорный патоген медоносных пчел 21 века.Environ Microbiol Rep 5: 17-29. DOI: https://doi.org/10.1111/1758-2229.12024. PubMed: 23757127.
  43. 43. Fries I (2010) Nosema ceranae у европейских медоносных пчел ( Apis mellifera ). J Invertebr Pathol 103: S73-S79. DOI: https: //doi.org/10.1016/j.jip.2009.06.017. PubMed: 197.
  44. 44. Higes M, Martin-Hernandez R, Meana A (2010) Nosema ceranae в Европе: эмерджентный ноземоз типа C. Apidologie 41: 375-392. doi: https: // doi.org / 10.1051 / apido / 2010019.
  45. 45. Paxton RJ (2010) Вызывает ли инфекция Nosema ceranae «расстройство коллапса колонии» у медоносных пчел ( Apis mellifera )? J Apicult Res 49: 80-84. DOI: https: //doi.org/10.3896/IBRA.1.49.1.11.
  46. 46. Sies H (1997) Окислительный стресс: оксиданты и антиоксиданты. Exp Physiol 82: 291-295. PubMed:
  47. 43.
  48. 47. Buchon N, Broderick NA, Poidevin M, Pradervand S, Lemaitre B (2009) Кишечный ответ дрозофилы на бактериальную инфекцию: активация защиты хозяина и пролиферация стволовых клеток.Клеточный микроб-хозяин 5: 200-211. DOI: https://doi.org/10.1016/j.chom.2009.01.003. PubMed: 19218090.
  49. 48. Vidau C, Diogon M, Aufauvre J, Fontbonne R, Viguès B et al. (2011) Воздействие сублетальных доз фипронила и тиаклоприда значительно увеличивает смертность медоносных пчел, ранее инфицированных Nosema ceranae . PLOS ONE 6: e21550. DOI: https: //doi.org/10.1371/journal.pone.0021550. PubMed: 21738706.
  50. 49. Dussaubat C, Brunet JL, Higes M, Colbourne JK, Lopez J et al.(2012) Патология кишечника и реакция на Microsporidium Nosema ceranae у медоносной пчелы Apis mellifera . PLOS ONE 7: e37017. DOI: https: //doi.org/10.1371/journal.pone.0037017. PubMed: 22623972.
  51. 50. González-Santoyo I, Córdoba-Aguilar A (2012) Фенолоксидаза: ключевой компонент иммунной системы насекомых. Entomol Exp Appl 142: 1-16. DOI: https: //doi.org/10.1111/j.1570-7458.2011.01187.x.
  52. 51. Lallès JP (2010) Щелочная фосфатаза кишечника: множественные биологические роли в поддержании гомеостаза кишечника и модуляции диетой.Nutr Rev 68: 323-332. DOI: https: //doi.org/10.1111/j.1753-4887.2010.00292.x. PubMed: 20536777.
  53. 52. ISO 5983 (1997) Корма для животных. Определение содержания азота и расчет содержания сырого протеина — метод Кьельдаля. Швейцария, Женева: Международная организация по стандартизации.
  54. 53. Folch J, Lees M, Sloane Stanley GH (1957) Простой метод выделения и очистки общих липидов из тканей животных. J Biol Chem 226: 497-509.PubMed: 13428781.
  55. 54. Louveaux J (1959) Recherches sur la récolte du pollen par les abeilles ( Apis mellifera L.). Annales De L’abeille 2: 99.
  56. 55. Постановление Комиссии (ЕС) № 152/2009 от 27 января 2009 г., устанавливающее методы отбора проб и анализа для официального контроля кормов. Официальный журнал Eur Union L 54 (26 февраля 2009 г.): 23–37.
  57. 56. Оу Б., Хэмпш-Вудилл М., Прайор Р.Л. (2001) Разработка и проверка улучшенного анализа способности поглощения радикалов кислорода с использованием флуоресцеина в качестве флуоресцентного зонда.J. Agric Food Chem., 49: 4619-4626. DOI: https: //doi.org/10.1021/jf010586o. PubMed: 11599998.
  58. 57. Baude M, Leloup J, Suchail S, Allard B, Benest D et al. (2011) Подстилка и взаимодействие растений влияют на содержание сахара в нектаре. Дж. Экол 99: 828-837. DOI: https: //doi.org/10.1111/j.1365-2745.2011.01793.x.
  59. 58. AFNOR 15662 (2009) Пищевые продукты растительного происхождения: универсальный метод определения остатков пестицидов с помощью ГХ-МС и SL / SM / MS экстракции / разделения с ацетонитрилом и очистки диспергированным SPE.
  60. 59. Crailsheim K, Stolberg E (1989) Влияние диеты, возраста и состояния колоний на протеолитическую активность кишечника и размер гипофарингеальных желез у медоносной пчелы ( Apis-Mellifera L ). J Insect Physiol 35: 595-602. DOI: https: //doi.org/10.1016/0022-1910 (89)
    -2.
  61. 60. Фишер П., Грозингер С.М. (2008) Феромонная регуляция устойчивости к голоданию у рабочих медоносных пчел ( Apis mellifera ). Naturwissenschaften 95: 723-729.DOI: https: //doi.org/10.1007/s00114-008-0378-8. PubMed: 18414825.
  62. 61. Томпсон Г.Дж., Йоки Х., Лим Дж., Олдройд Б.П. (2007) Экспериментальная манипуляция активацией яичников и экспрессией генов у маток и рабочих медоносных пчел ( Apis mellifera ): проверка гипотез регуляции репродуктивной функции. Журнал J Exp Zool Aecol Genet Physiology 307A: 600-610. DOI: https: //doi.org/10.1002/jez.415. PubMed: 17786975.
  63. 62. Alaux C, Brunet JL, Dussaubat C, Mondet F, Tchamitchan S et al.(2010) Взаимодействие между микроспорами Nosema и неоникотиноидом ослабляет медоносных пчел ( Apis mellifera ). Environ Microbiol 12: 774-782. DOI: https: //doi.org/10.1111/j.1462-2920.2009.02123.x. PubMed: 20050872.
  64. 63. Malone LA, Gatehouse HS (1998) Влияние инфекции Nosema apis на активность пищеварительного протеолитического фермента медоносной пчелы ( Apis mellifera ). J Invertebr Pathol 71: 169-174. DOI: https: //doi.org/10.1006/jipa.1997.4715.
  65. 64.Higes M, García-Palencia P, Martín-Hernández R, Meana A (2007) Экспериментальное заражение пчел Apis mellifera Nosema ceranae (Microsporidia). J Invertebr Pathol 94: 211-217. DOI: https: //doi.org/10.1016/j.jip.2006.11.001. PubMed: 17217954.
  66. 65. Forsgren E, Fries I (2010) Сравнительная вирулентность Nosema ceranae и Nosema apis у отдельных европейских медоносных пчел. Vet Parasitol 170: 212-217. doi: https: // doi.org / 10.1016 / j.vetpar.2010.02.010. PubMed: 20299152.
  67. 66. Боуниас М., Крук И., Некту М., Попескович Д. (1996) Токсикология солей меди на медоносных пчелах. V. Действие глюконата и сульфата на щелочные и кислые фосфатазы кишечника. Ecotoxicol Environ Saf 35: 67-76. DOI: https: //doi.org/10.1006/eesa.1996.0082. PubMed: 8930506.
  68. 67. Веб-сайт Comprehensive R Archive Network. Доступный: . http://www.R-project.org/. По состоянию на 28 мая 2013 г.
  69. 68. Cox DR (1972) Регрессионные модели и таблицы дожития.Биометрия 38: 67–77.
  70. 69. де Гроот А.П. (1953) Потребность медоносной пчелы в белках и аминокислотах ( Apis mellifica L.). Physiol Comp Oecol 3:. С. 197-285.
  71. 70. Bitondi MMG, Simões ZLP (1996) Взаимосвязь между уровнем пыльцы в рационе, витамином и титрами ювенильных гормонов у африканизированных Apis mellifera рабочих. J Apic Res 35: 27-36.
  72. 71. Хан Д.А., Денлингер Д.Л. (2011) Энергетика диапаузы насекомых.Анну Преподобный Энтомол 56: 103-121. DOI: https: //doi.org/10.1146/annurev-ento-112408-085436. PubMed: 206.
  73. 72. Тот А.Л., Кантарович С., Мейзел А.Ф., Робинсон Г.Е. (2005) Статус питания влияет на социально регулируемый онтогенез кормодобывания медоносных пчел. J Exp Biol 208: 4641-4649. DOI: https: //doi.org/10.1242/jeb.01956. PubMed: 16326945.
  74. 73. Герберт Э. У., Шимануки Х., Шаша Б. С. (1980) Выращивание выводка и потребление пищи пчелиными колониями, питаемыми заменителями пыльцы с добавлением экстрактов пыльцы, инкапсулированных в крахмал.J Apicult Res 19: 115-118.
  75. 74. Tasei JN, Aupinel P (2008) Питательная ценность 15 отдельных пыльцы и смесей пыльцы, протестированных на личинках, произведенных рабочими шмелей ( Bombus terrestris , Hymenoptera: Apidae). Apidologie 39: 397-409. DOI: https: //doi.org/10.1051/apido: 2008017.
  76. 75. Ли К.П., Симпсон С.Дж., Уилсон К. (2008) Качество диетического белка влияет на меланизацию и иммунную функцию у насекомых. Funct Ecol 22: 1052-1061. doi: https: //doi.org/10.1111 / j.1365-2435.2008.01459.x.
  77. 76. Клемола Н., Клемола Т., Рантала М.Дж., Руухола Т. (2007) Естественное качество растения-хозяина влияет на иммунную защиту насекомых-травоядных. Entomol Exp Appl 123: 167-176. DOI: https: //doi.org/10.1111/j.1570-7458.2007.00533.x.
  78. 77. Lee KP, Cory JS, Wilson K, Raubenheimer D, Simpson SJ (2006) Гибкий выбор диеты компенсирует белковые затраты на устойчивость к патогенам у гусеницы. Proc Biol Sci 273: 823-829. DOI: https: //doi.org/10.1098/rspb.2005.3385. PubMed: 16618675.
  79. 78. Брейкфилд П.М. (1987) Промышленный меланизм: есть ли у нас ответы? Trends Ecol Evol 2: 117-122. DOI: https: //doi.org/10.1016/0169-5347 (87)-6. PubMed: 21227832.
  80. 79. Campana BJ, Moeller FE (1977) Медоносные пчелы: предпочтение и пищевая ценность пыльцы из 5 растительных источников. J Econ Entomol 70: 39-41.
  81. 80. Сингх Р.П., Сингх П.Н. (1996) Спектры аминокислот и липидов личинок медоносной пчелы ( Apis cerana Fabr), питающихся пыльцой горчицы.Апидология 27: 21-28. DOI: https: //doi.org/10.1051/apido: 19960103.
  82. 81. Foley K, Fazio G, Jensen AB, Hughes WOH (2012) Ограничение питания и устойчивость к условно-патогенным паразитам Aspergillus у личинок медоносных пчел. Дж. Инвертебр Патол 111: 68-73. DOI: https://doi.org/10.1016/j.jip.2012.06.006. PubMed: 22750047.
  83. 82. Eguchi M (1995) Изоферменты щелочной фосфатазы у насекомых и сравнение с ферментом млекопитающих. Comp Biochem Physiol B Biochem Mol Biol 111: 151-162.DOI: https: //doi.org/10.1016/0305-0491 (94) 00248-S. PubMed: 7599983.
  84. 83. Le Conte Y, Navajas M (2008) Изменение климата: влияние на популяции медоносных пчел и их болезни. Rev Sci Tech Off Int Epiz 27: 499-510. PubMed: 18819674.

Питание сотового пчелиного воска | Livestrong.com

Соты содержат воск, мед и пчелиную пыльцу.

Соты — это восковые шестиугольные конструкции, построенные рабочими пчелами для хранения меда и пыльцы, а также для размещения развивающихся личинок.Медоносные пчелы производят воск, поедая собственный мед. Чтобы собрать мед, соты необходимо удалить, но их часто возвращают в улей, чтобы избежать чрезмерного налогообложения усилий рабочих пчел. Сырые соты едят, особенно с хлебом, хотя питательная ценность почти полностью зависит от меда, пыльцы и неразвитых личинок внутри сот, а не от пчелиного воска.

Соты

Соты состоят из шестиугольных восковых ячеек, построенных рабочими пчелами, которые должны потреблять более 8 фунтов.меда, чтобы произвести 1 фунт воска, согласно книге Джо Грэма «Улей и медоносная пчела». Таким образом, пчеловоды часто сохраняют восковые соты после извлечения меда, хотя также используются искусственные соты, что снижает нагрузку на рабочих пчел и позволяет пчеловоду продавать соты.

Пчелиный воск

Основным компонентом сот является пчелиный воск, который, как считается, не содержит питательных веществ, которые могут быть усвоены людьми, и, следовательно, не имеет калорийности.Употребление большого количества пчелиного воска может быть вредным для пищеварения, так как он не расщепляется в кишечнике. Согласно книге «Питание и заживление ран» пчелиный воск обычно продается как защитный бальзам для кожи и губ и обладает мягким противовоспалительным действием.

Медовый

Соты часто продаются с медом. Мед является хорошим источником простых сахаров, таких как сахароза и глюкоза, и легко усваивается для получения энергии. Необработанный мед также содержит аминокислоты, пищеварительные ферменты и некоторые витамины группы B.Согласно «101 еде, которая может спасти вашу жизнь», мед считается лечебной пищей, потому что он обладает антиоксидантными и антимикробными свойствами, которые устраняют свободные радикалы и препятствуют росту микроорганизмов соответственно.

Пчелиная пыльца и личинки

Соты также содержат пчелиную пыльцу и части личинок. Пчелиная пыльца представляет собой смесь пыльцы растений, нектара растений и слюны рабочих пчел, которые содержат пищеварительные ферменты. Пчелиная пыльца богата белком, клетчаткой, жирными кислотами и витаминами группы B, поэтому она продается как добавка, повышающая энергию.Хотя и не слишком аппетитно, чтобы думать о сотах, они также содержат небольшое количество неразвитых или мертвых личинок, что увеличивает содержание белка.

Меры предосторожности

Если у вас аллергия на укусы пчел, употребление сот может вызвать отрицательную реакцию, поэтому вам следует проявлять осторожность и проконсультироваться с врачом о возможных противопоказаниях.

Польза для здоровья меда и пчелиной пыльцы

Пчелиная пыльца и мед использовались в медицине в течение сотен лет, но какова их доказанная польза для здоровья?

Что такое мед и как его используют?
Пчелиная пыльца — это смесь слюны и нектара (или меда), полученная, когда молодые пчелы садятся на цветок.Пыльца переносится обратно в улей, где она затем хранится в сотах улья для ферментации пищи для пчелиной семьи. В самом сыром виде мед состоит из пчелиной пыльцы, пчелиного прополиса — соединения, которое получают из древесного сока — и множества антиоксидантов.

Сотни лет назад древние египтяне предлагали мед своим богам. Точно так же греческая, римская и китайская культуры использовали его в медицине для лечения ран, лихорадки и болезней желудка. Сегодня мед используется в лечебных целях и в качестве пищевой или пищевой добавки.

А как насчет обработанного меда?
Производители меда обычно пастеризуют сырой мед перед его продажей, то есть нагревают мед при высоких температурах, чтобы убить дрожжевые клетки и увеличить срок хранения меда. Следовательно, большая часть покупного меда имеет меньшую пищевую ценность из-за этого процесса.

Независимо от того, как он обрабатывается, мед по-прежнему содержит полезные для здоровья соединения, такие как антиоксиданты, аминокислоты и витамины. И хотя сырой мед содержит 16 г сахара на столовую ложку, исследования показывают, что он по-прежнему является более здоровой альтернативой столовому сахару.

Каковы преимущества для здоровья?
Исследования показывают, что и пчелиная пыльца, и мед имеют одинаковые преимущества для здоровья. Это неудивительно, поскольку пчелиная пыльца в целом составляет хорошее количество меда. Вот несколько основных преимуществ, поддерживаемых как древней философией, так и современной наукой:

  • Хороший источник антиоксидантов: Исследователи обнаружили, что употребление в пищу продуктов, богатых антиоксидантами, может снизить риск хронических заболеваний, таких как болезни сердца и диабет.Это включает растительные химические вещества, содержащиеся в пчелиной пыльце и сыром меде, которые могут содержать столько же антиоксидантов, сколько фрукты и овощи.
  • Природное антибактериальное и противогрибковое средство: Мед естественно содержит антисептик перекись водорода, что означает, что он может убивать вредные бактерии и грибки. Это означает, что мед можно использовать как антибактериальное и противогрибковое средство, в зависимости от индивидуальных свойств продукта.
  • Средство для заживления ран: Мед является кислым, что означает, что он может выделять кислород из раны и способствовать заживлению.В зависимости от конкретных свойств меда он может даже ускорить заживление и уменьшить инфекцию. Мед манука, произрастающий в Новой Зеландии, часто наносят непосредственно на небольшие порезы или ожоги, чтобы помочь убить микробы и восстановить ткани. Не рекомендуется обрабатывать порезы повседневным медом, приобретенным в магазине. Вместо этого поищите «сырой» альтернативу меду в разделе продуктов для здорового питания вашего продуктового магазина.

Имейте в виду, что использование пчелиной пыльцы и меда не рекомендуется, если у вас есть какая-либо форма пчелиной аллергии.Вам также следует опасаться продуктов с пометкой «чистый мед» или продуктов, в которых утверждается, что они получены из местных источников — если на этикетке не указано «сырой мед», продукт, скорее всего, пастеризован.

Независимо от того, покупаете ли вы мед сырой или покупной, помните, что вкус и срок хранения варьируются в зависимости от марки и продукта. Если вы думаете о включении меда или пчелиной пыльцы в свой распорядок дня, не забудьте поговорить со своим врачом, прежде чем вносить какие-либо изменения в свой рацион.

Эта статья впервые появилась в выпуске информационного бюллетеня HealthPerks за апрель 2020 г.

Мед 101: Пищевая ценность, польза для здоровья, типы и многое другое сахар-песок белый (сахар столовый). (9)

Но мед в основном представляет собой комбинацию глюкозы и фруктозы — одних и тех же сахаристых веществ, которые составляют белый сахар (хотя и в различных пропорциях), — а также других жидких подсластителей из природных источников, таких как агава и кленовый сироп. .(10,11) По сравнению с сахарным песком, мед слаще, калорийнее и содержит больше углеводов и общего сахара.

Одна столовая ложка (столовая ложка) меда, равная 21 грамму (г), обеспечивает около 60 калорий и 17 г углеводов (от 16 до 17 г из сахара), а 1 столовая ложка сахара-песка обеспечивает 49 калорий и 13 г углеводов (13 г из сахар). (12)

Природные антибактериальные свойства меда хорошо известны. В улье, когда исходный нектар обезвоживается и превращается в то, что мы называем медом, вырабатываются небольшие количества антисептической перекиси водорода.(13) Поскольку перекись водорода обладает антибактериальными свойствами, мед традиционно использовался в качестве местного лекарства и в настоящее время используется для ускорения заживления и предотвращения инфекций кожных ран, ожогов и язв, включая хирургические раны, пролежни, язвы диабетической стопы и различные виды язв на ногах.

Когда были разработаны современные антибиотики, лекарственное использование меда вышло из употребления. Но с появлением в последние десятилетия устойчивых к антибиотикам бактерий исследователи по-новому взглянули на антибактериальные свойства меда.Поскольку бактерии, как правило, не развивают резистентность к меду, у него есть терапевтический потенциал для использования в качестве антибиотика широкого спектра действия (который может лечить различные типы инфекций). Просто следуйте указаниям врача. Это потенциальное преимущество не превосходит известных преимуществ современной медицины.

Мед является предметом постоянных исследований в качестве потенциального ингредиента добавок и лекарств, которые можно использовать для лечения широкого спектра проблем со здоровьем, включая астму, болезни десен, болезни сердца, диабет 2 типа, диарею, грибковые инфекции, воспаления и т. Д. внутренние и внешние язвы, вирусы и даже некоторые виды рака.(9)

Поскольку до настоящего времени большинство экспериментов проводилось на лабораторных животных и в чашках Петри с использованием специально приготовленного медицинского меда, пока неясно, может ли и как именно мед может быть успешно использован людьми для большинства этих состояний. . Если будущие исследования подтвердят эффективность меда для людей, ученым также необходимо будет определить, какие виды меда достаточно эффективны, чтобы оказывать лечебное действие, и, при пероральном приеме, какое количество меда эффективно при различных состояниях.

Добавить комментарий

Ваш адрес email не будет опубликован.