Содержание

Санкт-Петербург | Из-за мужчины: звезда «Физрука» Полина Гренц страдала анорексией и булимией

Актриса рассказала о страшных последствиях резкого похудения.

Актриса Полина Гренц, полюбившаяся телезрителям после роли Саши Мамаевой в сериале «Физрук», рассказала о своем страшном опыте похудения. Девушка довела себя до анорексии и серьезных проблем со здоровьем. Вот уже год она расхлебывает последствия стремительного похудения. А все ради чего? Ради любви.

Посмотреть эту публикацию в Instagram

Публикация от Полина Гренц (@thepolinagrents) 3 Авг 2020 в 8:17 PDT

Девушка влюбилась в известного блогера, который периодически отпускал язвительные шуточки о ее фигуре. Тогда Полина записалась в спортзал и начала тренироваться через боль и слезы. Потом она попробовала несколько диет. А после распада отношений и вовсе зациклилась на изменении фигуры.

Актриса села на жесткую диету, прибегла к помощи детокс-клиники и принимала таблетки, отбивающие аппетит. Продолжалось это до тех пор, пока она не «превратилась в скелет» с весом 48 кг.

«Кожа серела, начали вылезать волосы, появились прыщи, мышц не было вообще», — вспоминает Гренц в своей исповеди, выложенной в соцсетях.

Помимо этого у Полины начались сильные желудочные боли и анемия. Постоянными гостями в квартире актрисы стали врачи скорой помощи. Со временем Гренц поняла, что пора остановиться, иначе может стать слишком поздно. Она обратилась за помощью к родителям.

«Самое главное, что я поняла, — я тратила очень много времени на то, чтобы угодить другим. Хотя в первую очередь должна была угодить себе, своему телу и здоровью», — предупреждает поклонников актриса.

Сейчас девушка чувствует себя намного лучше и уже набирает вес. По словам Полины, ей приятно наблюдать за изменениями своего тела и видеть, как оно становится подтянутым и спортивным. Подписчики поблагодарили Полину Гренц за откровенный рассказ и пожелали ей как можно скорее восстановиться.

звезда «Физрука» Полина Гренц страдала анорексией и булимией

Актриса рассказала о страшных последствиях резкого похудения.

Актриса Полина Гренц, полюбившаяся телезрителям после роли Саши Мамаевой в сериале «Физрук», рассказала о своем страшном опыте похудения. Девушка довела себя до анорексии и серьезных проблем со здоровьем. Вот уже год она расхлебывает последствия стремительного похудения. А все ради чего? Ради любви.

Девушка влюбилась в известного блогера, который периодически отпускал язвительные шуточки о ее фигуре. Тогда Полина записалась в спортзал и начала тренироваться через боль и слезы. Потом она попробовала несколько диет. А после распада отношений и вовсе зациклилась на изменении фигуры.

Актриса села на жесткую диету, прибегла к помощи детокс-клиники и принимала таблетки, отбивающие аппетит. Продолжалось это до тех пор, пока она не «превратилась в скелет» с весом 48 кг.

«Кожа серела, начали вылезать волосы, появились прыщи, мышц не было вообще», — вспоминает Гренц в своей исповеди, выложенной в соцсетях.

Помимо этого у Полины начались сильные желудочные боли и анемия. Постоянными гостями в квартире актрисы стали врачи скорой помощи. Со временем Гренц поняла, что пора остановиться, иначе может стать слишком поздно. Она обратилась за помощью к родителям.

«Самое главное, что я поняла, — я тратила очень много времени на то, чтобы угодить другим. Хотя в первую очередь должна была угодить себе, своему телу и здоровью», — предупреждает поклонников актриса.

Сейчас девушка чувствует себя намного лучше и уже набирает вес. По словам Полины, ей приятно наблюдать за изменениями своего тела и видеть, как оно становится подтянутым и спортивным. Подписчики поблагодарили Полину Гренц за откровенный рассказ и пожелали ей как можно скорее восстановиться.

Мечтай и делай! читать онлайн Полина Гренц (Страница 6)

Тем более что я стала замечать за собой, как стесняюсь своей фигуры! Да-да, мне стало казаться, что моя полнота всем заметна. И все пялятся на меня, в душе ужасаясь и осуждая. Я не могла нормально сходить на пляж — куталась в полотенца или парео и снимала их быстро, украдкой, чтобы вбежать в море и спрятать тело под водой.

Вот как человек зависит от своего внешнего вида! Вот как меняется психология — хочется укрыться, замотаться в слои одежды, стать невидимкой — только бы не заметили, что ты полный. А ведь я жила с этим весом лишь чуть более года! Что бы произошло еще через год? А через два?

«Ну нет, — решила я. — Это ненормально. Я так не хочу жить. И не буду».

И я села на диету.

Продержалась… неделю. И сорвалась.

Теперь-то я понимаю: это произошло исключительно потому, что у меня был неправильный настрой. Я относилась к диете как к испытанию. Ужасному, жестокому испытанию. Каждый вечер засыпала с мыслью: зачем в мире столько продуктов, которые нельзя есть? Как можно жить без вкусненького, сладенького, жирненького? Ведь это такая радость! Как можно лишать себя этой радости? «Ну так в чем проблема-то? — не понял мой организм. — Ну так и не лишай, делов-то. Пошли пожрем и постигнем дзен». Так что срыв диеты оказался всего лишь вопросом времени.

Запомните!

Не относитесь к диете и режиму питания как к наказанию. Мол, ты толстая, поэтому ужасная, невкусная диета — это твоя карма. Жуй листик салата и не жалуйся.

Наше подсознание очень умное — умнее, чем мы сами. Оно старательно избегает всего, что приносит нам дискомфорт. Поэтому если вы будете ненавидеть свой образ жизни и питания, то рано или поздно сорветесь. Или напрочь испортите характер. От вас разбегутся все друзья, и вы останетесь одинокой и злой. И даже не факт, что худой!

Та моя диета была основана на куриной грудке. Вареной, на пару или тушеной, но ни в коем случае не жареной. Грудка, грудка, одна сплошная грудка! Еще овощи на пару, блюда из свежих овощей и рыба. И ни грамма сладкого и мучного.

Я разработала ее сама — где-то что-то прочла, где-то с кем-то посоветовалась. Вспомнила, что еще в школе у меня обнаружили повышенный холестерин, и врач рекомендовал исключить из рациона колбасу, ограничить потребление соли и сахара. Я похудела тогда на три кило.

«Ага! — подумала я. — Пойдем привычным проторенным путем!»

В той диете слишком часто произносилось слово «нельзя» — или слишком редко «можно». Она была прежде всего психологически некомфортна. «Тебе нельзя это, это, это… не ешь то, то и то… А вот туда вообще не смотри, потолстеешь от одного вида!» В общем, это беда многих «самопальных диет».

Но я не хотела уступать и снова начала соблюдать режим питания.

Мне было очень тяжело отказываться от сладкого. Я в чай раньше всегда клала три ложки сахара! Даже обе мои бабушки поражались, как я могу пить чай с тремя ложками сахара… и с шоколадными конфетами вприкуску! Я обожала молочный и белый шоколад, особенно с начинками. А это просто удар по диете. Да, можно было горький, но мне не нравился его вкус. Однако похудеть мне хотелось больше, чем лопать конфеты, поэтому я постепенно стала привыкать к новому рациону. Несладкий чай. Фрукты на десерт. Даже полюбила темный шоколад.

Не прошло и месяца, как ушли несколько килограммов.

«Опа!» — сказала я. «Ага, сам в шоке!» — отозвался организм.

Мне это очень понравилось. Понравилось новое ощущение легкости — уже не казалось, что карманы одежды набиты камнями, в руках по гантельке. Понравилось, как чуть изменилась в зеркале моя фигура. Да даже то, как менялись цифры на весах, тоже было очень здорово!

Но я понимала, что эта диета принесла свои плоды потому, что у меня был явно лишний вес. Если же я хочу худеть дальше, мне надо будет очень серьезно заняться своим рационом.

Я обратилась к диетологу. Он-то и составил мою программу питания, которой я до сих пор придерживаюсь; окончательно же я утвердила ее в детокс-клинике, но о том, как я там привыкала к новому рациону, через мучения и почти трехдневную голодовку, расскажу чуть позже!

На съемки второго сезона «Физрука» я даже брала с собой еду в контейнерах, потому что предложенный на площадке обед не всегда совпадал с моим рационом. А-а-а-а, как я ненавидела людей, которые говорили: «Поешь нормальной еды, зачем тебе это? Ты и так худая». Ррррр! Это. Нормальная. Еда. Рассчитанная по граммам. Правильная. Наверное, даже вкусная. Не отвлекайте меня от нее!

Сейчас я питаюсь дробно: с утра — сложные углеводы. например овсянка (а ведь когда-то я ее не любила, а теперь ничего, распробовала), на обед белок, на ужин — клетчатка, в основном овощи. Но об этом расскажу отдельно.

Как и отдельно расскажу про спорт — ведь несмотря на то, что краеугольный камень похудения это питание, без спорта результатов не достичь.

Когда я пришла на съемочную площадку после двухмесячного перерыва, мне сказали: «У тебя так лицо похудело — щеки спали. Ты в кадре совсем другой человек». Как это было приятно! Искренне, честно, без абстрактных комплиментарных «похорошела, изменилась». После этого я решила, что буду активно худеть и дальше.

Да, возникли некоторые проблемы — ведь Саша Мамаева по сюжету еще оставалась полной, а меня такой уже нельзя было назвать при всем желании…

Все исправила великая магия кино! И поролон. Именно из него был сшит специальный костюм, который надевался по типу костюма для дайвинга. Не Карл Лагерфельд, скажу сразу, но со стороны казалось, что это мои реальные формы.

Правда, во время съемок в нем царило небольшое локальное пекло. Софиты, духота, я постоянно двигаюсь, а не лежу бревном… Я ужасно мучилась. Приходилось покупать в аптеке охлаждающие пакетики и бросать их в этот костюм.

Помогало, но ненадолго. Помню, снимали очередную серию в самый разгар лета. Солнце печет, жара, а я в поролоновом костюме — и поверх куча одежды. Внутри можно было самсу прилеплять и жарить.

Пришла домой, встала на весы — и ой! Сбросила за день около двух килограммов! Да уж, отличный оказался способ подсушить тело, вывести из организма токсины и лишнюю воду! Правда, чересчур уж экстремальный. Да и от пота и отсутствия воздуха чуть было не началось серьезное раздражение на коже…

Но, к счастью, к третьему сезону авторы сериала решили, что теперь в «Физруке» Саша Мамаева будет худенькой. Я была только рада. Во-первых, это позволило по-новому раскрыть ее образ: был милый забавный упитанный подросток, стала привлекательная интересная сильная девушка. Ну а во-вторых… сжечь, сжечь этот костюм!

В сериале в подробности похудения Саши вдаваться не стали. Просто один из персонажей, Псих, спрашивает: «Чего это ты, Мамаева, так схуднула?» Но она не отвечает. Вот такая загадочная!

Сейчас я вешу 52 килограмма. Последний раз такой вес был у меня в двенадцать лет!

Эти ощущения не описать словами! Так здорово ощущать себя хрупкой, тоненькой, изящной. Носить платья, которые подчеркивают фигуру, а не скрывают ее.

И очень весело читать новые комментарии: «Фотошоп», «Да это не она, это не ее фотка», «Да она же жирная, как так?», «Да по-любому фотошоп, в «Физруке» же она толстая». Ну упс, и тут кого-то разочаровала!

Когда лицо было полнее, мне нравились только мои глаза и нос. После похудения проявились скулы, и окружающие стали обращать внимание на то, что у меня красивые пухлые губы, которые на контрасте с изменившимся лицом выглядят очень сексуально. И это очень здорово, когда в тебе нет ничего искусственного — все твое, родное! И нужно было лишь немного поработать над собой, чтобы эти черты проявились.

Возможно, это прозвучит очень эгоистично, но сейчас я люблю в себе все! Раньше мне не нравились мои попа и бедра, однако теперь я довела свое тело до такого состояния, что мне не к чему придраться. Я стала выбирать одежду иного фасона, у меня появилось больше открытых вещей. Мне приятно получать комплименты — и моя самооценка, конечно, выросла. Я больше не просто «милая девчонка из соседнего двора», меня воспринимают как привлекательную девушку.

И это очень важно. Моей главной мотивацией было понравиться себе снова. И как бы сложно ни было (а было очень, очень сложно! Лишь со стороны кажется, что легко, вкусно и весело), именно это не давало мне опустить руки.

Потому что если нравишься себе, то нравишься и другим.

Я до сих пор сама себя мотивирую, смотря на старые фотографии, на отражение в зеркале и понимая, какой я стала сильной, какой я путь проделала.

Да, признаюсь, когда-то я ныла и говорила: «Я то-о-олстая» — и я была толстая! Потому что мы притягиваем к себе то, о чем думаем!

Сейчас я каждый день говорю себе, что я стройная, подтянутая и красивая. И да, я без ложной скромности горжусь проделанной работой!

Мне смешно, когда я встречаю гуляющую парочку — и мужчина смотрит на меня восхищенно, а девушка, заметив это, мысленно душит и расчленяет меня и его. Эй, подруга, что мешает тебе выглядеть так же? Займись собой, это же так просто! Я не профессиональная спортсменка, танцовщица или модель с годами суровых тренировок. Я обычная девчонка, которая сначала жесточайше нарушила все мыслимые и немыслимые режимы питания, а потом похудела без всякой черной магии.

Экс-участница «Холостяка» Полина Гренц страдала нервной булимией

Полина Гренц

25-летняя Полина Гренц признается, что впала в глубокую депрессию из-за округлых форм. Девушке хоть и удалось сбросить 16 килограммов после завершения съемок в сериале «Физрук», но тот период запомнится ей надолго. «В период похудения моя психика была подорвана, все дошло до нервной булимии. Я не обращалась к психологам, не считала нужным делиться этим с чужим человеком», — говорила она.

Сейчас артистка решила отбросить все комплексы и просто наслаждаться жизнью. Девушка продолжает следить за питанием, а также активно занимается спортом. Впрочем, делает это без фанатизма, желая в первую очередь чувствовать себя комфортно и выглядеть здоровой.

не пропустите«Холостяк» Антон Криворотов узнал неприятное прошлое своей фаворитки

«Я хочу принять себя такой, какая я есть, — делилась звезда. — Планирую записать видео и рассказать, как боролась с килограммами, потому что были истории, которые меня разрывали. Мы недавно говорили с мамой по телефону на эту тему и вместе ревели. Меня раздражает, что СМИ называют лишний вес проблемой, потому что это не так».

Хейтеры говорят, что актриса поправилась

Артистка не стремится достичь навязанных стандартов красоты. «Я не позволяю никому говорить: «Вот у тебя тут жирок, а тут бочок». У меня ничего этого нет. Поговорите с собой, поймите, почему вы считает себя толстой. Сейчас я не хочу никого слушать, самое главное — наладить отношения с собой», — признается звезда. 

К слову, переживать Полине пришлось и во время съемок «Холостяка». «В целом мне было комфортно на шоу, но под конец уже мелочи копились, все разрасталось как снежный ком, и на последнем свидании я взорвалась. У меня уже даже не было мыслей о том, как завоевать сердце Антона, я думала только, как спасти свое психическое состояние. Для меня это было сложно», — вспоминала она.

Гренц также призналась, что настоящим шоком для нее стало особенное отношение Криворотова к кубинской модели. «Мне кажется, что победит Барбара. Никто не знает точно, но с первой серии я так думаю, — уверена Гренц. — Я обалдела, когда увидела, как они целуются во второй серии. Мы ведь по большей части не знали, что происходило на свиданиях. В этом фишка шоу — это настоящая жизнь с своими трудностями».

По материалам Peopletalk

Фото: Legion-Media, Instagram

ТОП-5 актрис кардинально похудевших — фото

Ради стоящей роли актеры готовы не только на перевоплощения с помощью сложного грима и костюмов, но и на изнурительные эксперименты с собственным телом. Притом для съемок порой приходится не только худеть, но и набирать вес! А вернуться потом в привычную форму бывает очень непросто. Журнал «Лиза» вспоминает истории четырех российских актрис, которые сильно похудели в реальной жизни, хотя на экране все помнят их полненькими.

Полина Гренц

Ради роли в сериале «Физрук» девушке пришлось прибавить в весе. После съемок вернуться к былой фигуре было трудно. Для начала Полина села на диету, которая подразумевала только блюда на пару и никаких сладостей. После некоторых усилий вес начал уходить, а актриса научилась пить несладкий чай и любить темный шоколад. Сбросить в общей сложности ей удалось 16 килограммов.

«Такой стройной, как сейчас, я не была никогда. Не сказать, что раньше я была чересчур толстой, но пухленькой была всегда. А сейчас я вешу 52 килограмма. Последний раз у меня такой вес был лет в 12—13», — делится девушка.

Кадр из сериала «Физрук»; Instagram @thepolinagrents

Светлана Пермякова

Конечно, актрису помнят зрители по роли сердобольной медсестры Любы в сериале «Интерны». Ну, а самые заядлые поклонники и по образу хамоватой Светки из команды КВН «Парма». И там, и там артистка была умеренно полной, но отнюдь не супермоделью. Но после завершения ситкома решила взять себя в руки и привести фигуру в более симпатичный вид. В результате тяжелой работы над собой Светлана избавилась от 12 лишних килограммов.

«Скажу честно, когда я решила худеть, — это был тяжкий труд, который позволил сделать определенные выводы. Что кому-то везет, и мамина-папина генетика дарит фигуру, ради которой и трудиться не приходится. Мне же в итоге пришлось признать, что афродитовой стройности я не достигну, как ни старайся. Я консультировалась с диетологом, потом следовала его рекомендациям, но в итоге пришла к нынешнему весу, который для моего самочувствия оказался оптимальным», — рассказывает Пермякова.

По словам артистки, она не отказывалась от сладкого и других продуктов, но существенно уменьшала порции. Это дало свои плоды, но стоило ей больших усилий.

Кадр из сериала «Интерны»; Instagram @s_permyakova

Ирина Пегова

Актриса в детстве занималась художественной гимнастикой, поэтому была стройной. Но с возрастом фигура стала более величественной, а после рождения дочери долго не получалось вернуться к стройности. Зрители запомнили ее этакой пышечкой в картинах «Прогулка», «Пять невест», сериале «Варенька». Но теперь Ирина взялась за свой рацион и резко его урезала. Актриса признается, что есть старается мало, много пьет воды и бегает. Отказ от излишеств позволил ей убрать десять килограммов.

«Главное правило — есть надо медленно. В идеале обед занимает час. И объем порции должен равняться размеру вашего кулачка», — советует Ирина Пегова.

Кадр из сериала «Варенька»; Instagram @pegovairina

Анастасия Денисова

У этой артистки были все трудности в работе с весом. Сначала для работы в сериале «Деффчонки» ей пришлось набрать 15 килограммов! И давалась такая перемена ей нелегко: первые пять кило пришли только через месяц, потом еще столько же в начале съемок и последняя пятерка в процессе работы на площадке. Но жить с новым весом было некомфортно, и постепенно продюсеры разрешили артистке худеть. От 15 килограммов она избавилась за полтора месяца! Правда, сделать это было не легче, чем в начале набрать вес.

«Начав правильно питаться, я пристрастилась к кардиотренировкам — это беговая дорожка, велосипед, эллипс. Теперь посещаю фитнес-клуб два-три раза в неделю», — вспоминает Анастасия.

Кадр из сериала «Деффчонки»; Instagram @anastasiyadenisovafilm

Александра Бортич

Ради роли в сериале «Я худею» молодая актриса набирала вес полтора месяца. По условиям контракта, она должна была поправиться на 20 килограммов, а потом за месяц в течение съемок вернуться к прежней фигуре. Это стоило ей практически титанических усилий.

«Всем кажется, что есть какой-то магический способ, а на самом деле его нет. Я перешла на правильное питание, тренировалась шесть дней в неделю, ходила на болезненный массаж… И до сих пор продолжаю работать над собой», — говорит Александра Бортич.

Кадр из фильма «Я худею» 2018 г; [email protected]

Ранее 5-tv.ru рассказывал, как сбросивший центнер Максим Фадеев раскрыл секрет похудения.

Победили широкую кость: звезды, которые сильно похудели

Многие знаменитости стараются поддерживать привычный для поклонников образ. Но некоторым удается взяться за свое здоровье и кардинально преобразиться, распрощавшись с лишними килограммами.

Полина Гренц

Посмотреть эту публикацию в Instagram

Публикация от @starsboom20

Звезда сериала «Физрук» Полина Гренц смогла похудеть на 14 килограммов. Сбросить лишний вес артистке помог квалифицированный диетолог. С помощью специалиста Полина начала питаться дробно, а также подключила интенсивные физические нагрузки.

Ирина Дубцова

Посмотреть эту публикацию в Instagram

Публикация от @starsboom20

Преображение Ирины Дубцовой мало кого оставляет равнодушным. Ведь певица долгое время была пышкой, а однажды показала свою стройную фигуру. На 18 килограммов Ирина похудела благодаря бессолевой диете и липосакции. Дубцова не скрывает, что ложилась на операцию, чтобы привести себя в форму.

Адель

Посмотреть эту публикацию в Instagram

Публикация от @starsboom20

Британская певица Адель похудела на 45 килограммов после разрыва с мужем. Во многом ей помогла мысль о здоровье собственного тела, ведь на тот момент она осталась одна с подрастающим сыном. Артистка признавалась, что тренажерный зал вгонял ее в тоску, поэтому она начала заниматься регулярными пробежками. Кроме того, она открыла для себя систему питания сиртфуд, которая запустила процесс похудения. Врачи рекомендуют всегда советоваться с диетологами, чтобы правильно определить ту пищу, которая подходит конкретно каждому человеку и вписывается в систему питания.

Полина Гагарина

Посмотреть эту публикацию в Instagram

Публикация от @starsboom20

Певица Полина Гагарина также похудела на 40 килограммов. Набор веса у артистки случился во время беременности и задержался после рождения ребенка. Сбросить лишний вес артистке помогла жесткая диета и физические нагрузки на работе. По словам Полины, тогда она за полгода «сдулась» на тридцать килограммов, а остальной лишний вес она скинула более плавно.

Настя Каменских

Посмотреть эту публикацию в Instagram

Публикация от @starsboom20

Насте Каменских в свое время удалось похудеть на 18 килограммов. По словам артистки, она худела с помощью правильного питания и регулярных физических нагрузок. В одном из интервью Настя отметила, что спорт нужно подключать постепенно, чтобы организм привык к нагрузкам.

Сергей Нетиевский

Посмотреть эту публикацию в Instagram

Публикация от Сергей Нетиевский (@netievskiy_official)

Артист Сергей Нетиевский похудел на 25 килограммов и изменился до неузнаваемости! Сергей худел с помощью специалистов, которые составили для него три списка питания: красный, желтый и зеленый. Также врачи ему рассказали, какие продукты будут способствовать его похудению, а каких стоит избегать.

Ребел Уилсон

Посмотреть эту публикацию в Instagram

Публикация от Rebel Wilson (@rebelwilson)

40-летняя актриса Ребел Уилсон похудела на 20 килограммов Специалисты отправляли артистку худеть в специальный центр детоксикации. Там ее рацион составляла высокощелочная пища, а также интервальное голодание. Врачи следили за тем, чтобы Ребел научилась тщательно пережевывать пищу: каждый кусочек необходимо жевать не менее 40 раз. 

К слову, многие знаменитости сильно преобразились не только после похудения: ​А был ли улучшайзинг: сравниваем внешность звезд до своей популярности и после. Впрочем, некоторых селебрити не узнать после смены гардероба: ​Фрик на фрике: как выглядели звезды отечественной эстрады в лихие 90-е.

полина и после похудения

полина и после похудения

полина и после похудения

>>>ПЕРЕЙТИ НА ОФИЦИАЛЬНЫЙ САЙТ >>>

Что такое полина и после похудения?

Keto Dieta (Кето Диета) – капсулы для приема во внутрь, основанные на кетоновых телах естественного происхождения и вспомогательных активных натуральных эссенциях. Капсулы прекрасно останавливает усвоение жира и ликвидирует подкожные жировые клетки, благодаря чему тело быстро теряет вес.

Эффект от применения полина и после похудения

Были проведены многочисленные клинические исследования, которые показали, что представленный препарат действительно эффективный. Его формула не имеет аналогов, потому как все компоненты подбирали лучше врачи. Кето Диета бережно воздействует на организм и не вредит внутренним органам. При этом препарат активирует метаболизм, запускает процесс сжигания жира и повышает общий тонус. Люди, которые принимали средство, могут подтвердить его эффективность. Результат наступает в первую неделю после начала курса.

Мнение специалиста

Инструкция по применению предельно проста. Капсулы Кето Диета нужно принимать 2 раза в день (1-2 капсулы) за 20-30 минут до еды. Длительность курса зависит от поставленной цели (тяжести ожирения, физических характеристик реального больного). Судя по отзывам врачей, обычно для стойкого похудения достаточно 4-6 недель. За это время при правильном подходе можно потерять 10-12 килограммов.

Как заказать

Для того чтобы оформить заказ полина и после похудения необходимо оставить свои контактные данные на сайте. В течение 15 минут оператор свяжется с вами. Уточнит у вас все детали и мы отправим ваш заказ. Через 3-10 дней вы получите посылку и оплатите её при получении.

Отзывы покупателей:

Даша

Основные достоинства комплекса Кето Диета: худеть легко и просто, первые результаты — уже через несколько дней; можно избавиться от 5 и выше килограмм в зависимости от первоначального веса; для людей разного возраста, начиная с 18 лет; работает без противопоказаний и побочных эффектов, действие таблеток является безопасным; 100% природные компоненты в составе, дающие возможность комплексно оздоровить организм в результате приема; использовать просто и экономично, всего 1 таблетку в день; инструкция по применению есть на каждой упаковке средства; стоимость на официальном сайте производителя невысокая благодаря тому, что продается добавка только в интернете; быстро устраняет проблемы с кожей, этим особенно отличается от других средств. Она не только не обвисает в результате быстрого похудения, но наоборот, становится гладкой и ровной.

Евгения

Инструкция по применению капсул для похудения Keto Dieta: За полчаса до приема пищи выпить 1-2 капсулы. Запить водой. Принимать два раза в сутки. Как пишет производитель, вес начнет убывать уже после 2-3 дней приема.

Комплекса Кето Диета улучшает процессы пищеварительной системы и обмен веществ, нормализует гормональный баланс, успокаивает. Способствует снижению веса, при котором не нужны физические нагрузки. Расщепление жиров происходит быстро, без побочных действий благодаря натуральному составу и биологически активным веществам в нем. Где купить полина и после похудения? Инструкция по применению предельно проста. Капсулы Кето Диета нужно принимать 2 раза в день (1-2 капсулы) за 20-30 минут до еды. Длительность курса зависит от поставленной цели (тяжести ожирения, физических характеристик реального больного). Судя по отзывам врачей, обычно для стойкого похудения достаточно 4-6 недель. За это время при правильном подходе можно потерять 10-12 килограммов.
Похудение после 2 беременности. В 2016-2017 гг. певица скрывала от публики интересное положение вплоть до конца срока. . Разрешенные и запрещенные продукты. Полина Гагарина фото до и после похудения размещает в соцсетях сама. Они могут стать мотивацией для тех, кто решил избавиться от. Реальная история похудения от Полины. Как Полина Гагарина похудела на 40 кг, она сама все-таки рассказала на телепередаче. . Еще одно правило — ни ложки даже пресного риса после шести вечера! Как похудела Полина Гагарина на 40 кг? Рецепт, фото певицы. При такой диете много лишнего жира уйдет за. Российская певица и композитор Полина Гагарина, фото до и после похудения которой просто наводнили интернет, – кумир очень многих. Особенно интересен её способ быстрого похудения. Эффективное похудение Полины Гренц. Нередко в вопросах похудения и здорового образа жизни люди ориентируются . Молодая российская актриса Полина Гренц, сыгравшая выпускницу школы Сашу Мамаеву в сериале Физрук, после. Как похудела Полина Гренц? Фото до и после похудения. Диета и секреты преображения Саши Мамаевой из Физрука. . Из пышки в худышку. Как похудела звезда Физрука Полина Гренц. Опубликовано: 27-06-2016 0 4.3. Как похудела Полина Гагарина, разница в весе певицы раньше и сейчас. Постройневшая звезда и ее секреты избавления от лишних . Разница в весе, которую демонстрирует Полина Гагарина до и после похудения, впечатляет всех. И немудрено, ведь за полгода ей удалось сбросить значительное. После похудения Полина Гагарина, рост и вес которой восхищает поклонников уже несколько лет, пересмотрела свой рацион. Она любит, как и прежде, побаловать себя сладостями и булочками, но делает это редко. Полина Гагарина сделала пластику или ее лицо изменилось благодаря похудению? Посмотрите фото Полины Гагариной в детстве, юности и сравните с тем, как певица выглядит сейчас. Узнайте, сколько лет Полине Гагариной. полина гагарина фото до и после похудения. Похудение Полины Гагариной совпало со сменой образа. Стилист Александр Шевчук, случайно оказавшийся соседом Полины в самолете, посоветовал новую прическу. Питание после похудения. После того как похудела Гагарина, ее рацион и методы питания практически не изменились. . Она признается, что последнее время начала злоупотреблять кофе. Полина Гагарина до похудения и после – фото.
https://www.sunmold.com/upload/uglevodnoe_pokhudenie2434.xml
http://www.dudikom.pl/userfiles/kak_pravilno_delat_planku_dlia_pokhudeniia7734.xml

http://www.ceccarmehedinti.ro/userfiles/skolko_mozhno_pokhudeniia1630.xml
http://www.bitcz.eu/files/otrubi_dlia_pokhudeniia1351.xml
Были проведены многочисленные клинические исследования, которые показали, что представленный препарат действительно эффективный. Его формула не имеет аналогов, потому как все компоненты подбирали лучше врачи. Кето Диета бережно воздействует на организм и не вредит внутренним органам. При этом препарат активирует метаболизм, запускает процесс сжигания жира и повышает общий тонус. Люди, которые принимали средство, могут подтвердить его эффективность. Результат наступает в первую неделю после начала курса.
полина и после похудения
Keto Dieta (Кето Диета) – капсулы для приема во внутрь, основанные на кетоновых телах естественного происхождения и вспомогательных активных натуральных эссенциях. Капсулы прекрасно останавливает усвоение жира и ликвидирует подкожные жировые клетки, благодаря чему тело быстро теряет вес.
Потратьте немного времени и создайте индивидуальное меню для похудения на каждый день, пользуясь несколькими . Корректировать вес поможет недорогое и простое меню для похудения на неделю. Такой дневной рацион удобен для тех, у. Важно расписать меню на каждый день по часам. Чтобы перейти на правильное питание для похудения домашних условиях, важна постепенность. Нужно плавно убирать из привычного меню пищу, которая содержит простые углеводы. Это сладкое, выпечка, жареное, копченое и другая вредная еда. Меню ПП, разработанное на день и неделю, для качественного похудения включает определенные продукты, которые нужно . Нельзя составить один рацион ПП на неделю для похудения и питаться так месяц. Менять меню нужно каждую неделю, чтобы избежать срывов. Какие продукты можно и нельзя кушать при. поэтому мы можем использовать меню правильного питания на каждый день для похудения с рецептами не только в . С помощью предложенного диетического меню правильного питания, мы сможем похудеть примерно на 3 кг за неделю. Первый день правильного питания для похудения. Меню на завтрак. Похудение. Меню на каждый день. Правильное питание. . При этом питание лучше делать пятиразовым, чтобы в течение дня избежать чувства подступающего голода, который и подталкивает человека набрасываться на вредные продукты и съедать на одни прием намного больше, чем того требует внутренняя. Представляем Вам меню правильного питания для похудения на каждый день. Рацион может быть очень гибким и меняться относительно ваших предпочтений и вкусов. Кроме того, при желании Вы можете составить для себя 2-3 подобных меню. Правильное питание – меню на каждый день. Помните, каждый день в рацион должны входить нежирное мясо, рыба . Рекомендации для ПП меню на неделю для похудения. Составляя список, смотрите на продукты, которые будут в него входить. Распределяйте их по разным дням. Никогда не пропускайте. Эффективная и здоровая диета для похудения с подробным меню. . Диета на каждый день. Первый приём пищи должен осуществиться не позднее 9 часов утра. Второй – примерно в 12 часов дня, третий – в период с 14:00 до 15:00, четвёртый – с 16:00 до 17:00, и последний приём пищи в 19:00. Как видите, кушать. Необходимо грамотно составить меню на каждый день. Но для начала необходимо придерживаться правил употребления пищи. . Меню на неделю для похудения на 10 кг для мужчин. Составив меню на неделю, у вас будет возможность заранее закупить необходимые продукты. При подборе продуктов.

Общегеномный генный анализ вмешательств по снижению веса определяет потенциальную роль NKX6.3 в метаболизме

Этика

Местные комитеты по этике исследований на людях из больницы Оттавы и исследований DiOGenes одобрили исследование, и все процедуры были проведены в в соответствии с Хельсинкской декларацией. Все участники дали информированное письменное согласие перед любым тестированием.

Образцы для исследования

Канадские образцы состояли из пациентов, зарегистрированных в клинике контроля веса 16 , которые прошли 6–12-недельный курс заместительной еды, состоящий из продукта Optifast900, доступного только в Канаде (Nestlé Health Science, Швейцария).Критерии соблюдения программы включали: посещение 75% клинических сессий и строгое соблюдение режима замены еды (оценивается по количеству потребленных продуктов, заменяющих прием пищи). Пациенты, принимающие лекарства, о которых известно, что они влияют на скорость потери веса, гомеостаз глюкозы или аномальные показатели щитовидной железы, были исключены из анализа. В общей сложности 1436 субъектов Optifast900 соответствовали критериям генотипирования и имели доступные измерения веса.

Исследование DiOGenes (NCT003

) — интервенционное многоцентровое панъевропейское исследование 17,18 .В исследовании приняли участие восемь партнеров: Болгария, Чешская Республика, Дания, Германия, Греция, Нидерланды, Испания и Великобритания. Участники следили за 8-недельным ЖК-дисплеем. ЖК-дисплей давал 800 ккал в день с использованием заменителя пищи (Modifast, Nutrition et Santé France). Участники также могли съесть до 400 г овощей (что соответствует максимальной добавке 200 ккал / день). Всего для генотипирования было включено 888 субъектов DiOGenes. Макроэлементный состав двух продуктов-заменителей пищи был признан аналогичным (жир = 17% и 14%; белки = 34 и 42% и углеводы = 49 и 44%, соответственно, для продуктов Optifast и Modifast).

Клинические данные

В канадском исследовании Optifast900 вес измеряли еженедельно во время операции ЖКД. В исследовании DiOGenes вес измерялся на исходном уровне и через 1, 3, 5, 7, 8 недель ЖКД. Временная точка 5-я неделя предоставила наибольший размер выборки (т.е. наименьший процент пропущенных значений) для обеих когорт. Анализы исследовали ИМТ после 5 недель ЖКД с поправкой на исходный ИМТ, возраст и пол.

Данные генотипа

Данные генотипа были получены с использованием HumanCoreExome-12 v1.1 с 264 909 метками маркера SNP и 244 593 маркерами, сфокусированными на экзоме. Они обрабатывались с помощью платформы Illumina TM в соответствии с инструкциями производителя Infinium® HD Assay Ultra, Manual. Генотипы были определены с помощью программного обеспечения GenomeStudio (Illumina). Из контроля качества исключены SNP с частотой вызовов <95%, нарушающими равновесие Харди-Вайнберга (FDR <20%), низкой частотой минорных аллелей <1%. Субъекты были исключены, если у них была низкая частота звонков (<95%), аномально высокая аутосомная гетерозиготность (FDR <1%), кариотип XXY или гендерные несоответствия между данными генотипа и историями болезни.Для субъектов с высокой степенью идентичности по состояниям (IBS> 95%) оставался только тот, у которого была самая высокая частота звонков. Анализ главных компонентов (PCA) проводился независимо для каждой когорты, чтобы исключить субъектов, которые были отклоняющимися с точки зрения генетической структуры. Все испытуемые из обеих когорт были европейского происхождения, и две когорты имели сходную генетическую структуру (дополнительный рис. 1). После всех генетических QC 1166 субъектов из Оттавы и 789 участников DiOGenes были оставлены для последующих анализов.

Затем было выполнено вменение генотипа с использованием SHAPEIT 62 и IMPUTE2 63 на основе европейской контрольной панели из проекта 1000 Genome 64 (выпуск за март 2012 г., фаза 1, версия 3).Постфильтрация импутации удалила SNP с частотой референсных аллелей менее 1% и оценкой INFO <0,8. После такой фильтрации для обоих наборов данных были доступны данные для 4,9 млн условно исчисленных SNP.

Функциональный анализ мухи

Штаммы мух: Мухи содержались на стандартной диете с агаром, сахаром и дрожжами и выращивались в инкубаторе при 25 ° C при темноте 12/12 и ночном цикле. Actin-Gal4 и TubGal80ts были от Блумингтона. UAS-Ank IR1 (GD25945), UAS-HGTX IR (GD12608), UAS-HGTX IR1 (KK109732), UASCG3209 UASCG3209 900 (KK10281) были от VDRC. UAS-Ank OE был от доктора Рональда Р. Дубрейла, а UAS-HGTX OE (9932) был от Блумингтона.

Анализ триглицеридов: пять самцов мух взвешивали и гомогенизировали в 200 мкл PBST (PBS + 0,05% Tween 20) на льду, затем обрабатывали ультразвуком в течение 10 с с использованием ультразвукового зонда на льду. После обработки ультразвуком добавляли 800 мкл охлажденного на льду PBST и тщательно перемешивали. Пятьдесят микролитров смеси использовали для определения триглицеридов с использованием набора триглицеридов Roche (11730711216) в соответствии с инструкциями производителя, и 10 мкл смеси использовали для определения содержания белка с использованием набора для анализа белков Брэдфорда (Sigma).Триглицериды были нормализованы до уровня белка.

Анализ гликогена: гликоген определяли путем измерения глюкозы, разложенной из гликогена, с использованием амиоглюкозидаз. Пять самцов мух гомогенизировали и растворяли в 1 М растворах КОН. После двукратной экстракции 95% этанолом осадок ресуспендировали в 1 мл буфера для амиоглюкозидазной реакции (0,3 мг / мл в 0,25 М ацетатном буфере, pH 4,75) и инкубировали в инкубаторе со встряхиванием при 37 ° C в течение ночи и проводили анализ глюкозы.

Анализ трегалозы: трегалозу определяли путем измерения глюкозы, разложенной из трегалозы, с использованием трегалозазы.Головы двадцати самцов мух гомогенизировали в 200 мкл ледяного ТВ-буфера (5 мМ Tris pH 6,6, 136 мМ NaCl, 2,7 мМ KCL), затем центрифугировали при 4 ° C в течение 5 минут на максимальной скорости и собирали супернатант. 20 мкл супернатанта использовали для измерения глюкозы и белка соответственно. Пятьдесят микролитров супернатанта смешивали с 50 мкл раствора TE (10 мкл трегалозы в 1,5 мл буфера TB). Инкубировали при 37 ° C в течение ночи. Центрифугировали при 4 ° C на максимальной скорости в течение 3 минут, а затем 20 мкл супернатанта использовали для измерения уровня глюкозы.

Анализ глюкозы: 50 мкл смеси использовали для определения [глюкозы] с использованием набора Thermo Infinite Gluosis Kit (TR15421) в соответствии с инструкциями производителя.

Масса тела: массу тела измеряли с помощью аналитических весов.

Анализ потребления пищи: потребление пищи измеряли в течение 24 часов с помощью теста CAFE. Пустые флаконы использовали для контроля испарения. Все эксперименты были установлены во время Zeitgeber 6–8, запись о приеме пищи начиналась через 24 часа после загрузки пищи.

Анализ голодания: самцов мух помещали в пробирки DAM2 с 2% агаром и за гибелью наблюдали каждый час.

кПЦР: 1 мкг мРНК подвергали обратной транскрипции в кДНК с использованием системы синтеза первой цепи SuperScript® III (Invitrogen). Все праймеры, используемые для количественной ПЦР, были предварительно проверены на эффективность и специфичность. ОТ-ПЦР выполняли с использованием набора датчиков Sensimix TM (Bioline). Программа следующая: 95 ° C 10 мин, 40 циклов 95 ° C, 15 с; 55 ° C, 15 с; 72 ° C, 15 с. Реакции проводили на Light Cycle® 480 (Roche). Экспрессию гена нормализовали по эталонному гену rp49. Используются следующие праймеры:

HGTX вперед: CGAGTCGCAGGTTAAGGTCT;

HGTX Реверс: CCGCCCATATCGTCCTGTTT;

Rp49 вперед: CGGATCGATATGCTAAGCTGT;

Rp49 реверс: GCGCTTGTTCGATCCGTA;

Ilp2 нападающий: TGAGTATGGTGTGCGAGG;

Ilp2 Реверс: CTCTCCACGATTCCTTGC;

Ilp3 вперед: GAACTTTGGACCCCGTGAA;

Ilp3 Реверс: TGAGCATCTGAACCGAACT;

Ilp5 нападающий: CAAACGAGGCACCTTGGG;

Ilp5 Реверс: AGCTATCCAAATCCGCCA;

Дот-блот: Иммуноблоттинг проводили с использованием дот-блоттинга и следуя протоколу, аналогичному Kim et al. 65 . Десять мух гомогенизировали в PBS с ингибиторами протеиназ, и остатки центрифугировали при скорости 12000 g в течение 2 минут, затем образцы разбавляли в соотношении 1: 200 и 0,4 мкл образцов наносили по каплям на нитроцеллюлозную мембрану, образец без Ilp3 использовали в качестве отрицательного результата. контроль. Последующие этапы протокола включали: блокирование 5% BSA в TBS-T (0,5–1 час, RT), инкубирование с первичным антителом (0,1–10 мкг / мл для очищенных кроличьих антител против Ilp3, любезно предоставленных доктором Яном Винстра). , Bordeaux University France 66 ), 1: 500 растворяли в BSA / TBS-T в течение 30 минут при комнатной температуре.Трижды промыть TBS-T (3 × 5 мин), инкубировать со вторичным антителом, конъюгированным с HRP, в течение 30 мин при комнатной температуре, трижды промыть TBS-T (15 мин × 1, 5 мин × 2), затем один раз с TBS. (5 мин), инкубировать с реагентом ECL в течение 1 мин, накрыть пленкой Saran. Для окрашивания кумасси такое же количество супернатанта помещали в нитроцеллюлозную мембрану, и окрашивание кумасси синим добавляли в нагруженные белком области несколько раз до тех пор, пока цвет больше не перестанет изменяться, и мембрану один раз промывали TBST для визуализации.Изображения были сделаны с использованием системы ChemiDoc (Bio-rad). Количественный анализ проводили с использованием программного обеспечения Image J.

Статистический анализ

Анализ одиночного SNP был выполнен с использованием BOLT-LMM 24 , байесовской линейной модели смешанного эффекта для корректировки структуры популяции и загадочного родства между людьми. Скорость потери веса была скорректирована с учетом пола, возраста и начального ИМТ. Результаты двух когорт впоследствии были подвергнуты метаанализу с использованием программного обеспечения для полногеномного ассоциативного метаанализа (GWAMA) 67 с моделированием случайных эффектов и корректировкой двойного геномного контроля (GC) 68 (GC-коррекция на уровне исследования). а также на уровне метаанализа).

Анализ на основе генов был выполнен с использованием подхода VEGAS (универсальное исследование ассоциаций на основе генов) 20 . Этот метод интегрирует одиночные SNP p -значения на уровне гена и учитывает паттерны LD посредством моделирования Монте-Карло. Анализ проводился со следующими настройками: европейская родословная популяция из проекта «1000 геномов» в качестве эталонной популяции для паттернов LD, основанный на наборах тест с использованием верхних 80% SNP и размер блока гена, установленный на 20 kb. Такая настройка присваивает каждому гену его соседние SNP (в пределах 20 т.п.н.) и отбрасывает 20% SNP, имеющих наименее значимое значение p .Для регионов с близко расположенными генами (например, кластеры генов) потенциально одни и те же SNP могут быть отнесены к разным генам, что приводит к разным «генам-локусам», имеющим сходные значения p . Это не проблема, поскольку цель такого анализа состоит только в том, чтобы выделить локусы, связанные с интересующим признаком. Корректировка для множественного тестирования была выполнена с использованием поправки Бенджамини-Хохберга 69 . Порог значимости для всего генома был установлен на FDR <5%.

Приоритезация сигналов GWA была выполнена с использованием байесовской структуры для моделирования совместной вероятности ассоциации p -значений с крупномасштабными эпигеномными аннотациями.Такой вывод о вариации риска был выполнен с использованием структуры RiVIERA-beta 21 и 450 эпигеномных аннотаций (включая гистоновые метки, гиперчувствительность к ДНКазе I, связывание факторов транскрипции и локализацию в экзонах). Цель этой структуры состоит в том, чтобы вывести для каждого входного SNP апостериорную вероятность заболевания с учетом его ассоциации p -значение и перекрытия в функциональных аннотациях. Эпигеномные аннотации были взяты из Pickrell et al. 70 .

Анализ фенотипов мух выполняли с использованием однофакторного дисперсионного анализа с поправкой Бонферрони для множественных сравнений.

Программное обеспечение

Общий статистический анализ был выполнен с использованием статистической среды R версии 3.3.1. Мы использовали LocusZoom, чтобы построить региональную ассоциацию и LD с ведущим SNP с использованием данных о популяции 1000 геномов CEU (hg19 / 1000 Genomes, март 2012, евро). Эпигеномные графики были сделаны с использованием пакета Bioconductor Gviz. Изображение J использовали для количественной оценки результатов дот-блоттинга.

URL-адреса

Для Bolt-LMM см. Https://data.broadinstitute.org/alkesgroup/BOLT-LMM/; для GWAMA см. http: // www.geenivaramu.ee/en/tools/gwama; для Impute2 см. http://mathgen.stats.ox.ac.uk/impute/impute_v2.html; для GenABEL см. http://www.genabel.org/; для Gviz см. https://bioconductor.org/packages/release/bioc/html/Gviz.html; для Riviera-beta см. https://yueli-compbio.github.io/RiVIERA-beta/; для LocusZoom см. http://locuszoom.org/; для изображения J см. https://imagej.net.

Сводка отчетов

Дополнительная информация о планах экспериментов доступна в Сводке отчетов по исследованиям природы, связанной с этой статьей.

(PDF) Общегеномный генетический анализ вмешательств по снижению веса определяет потенциальную роль NKX6.3 в метаболизме

Сводка отчета. Дополнительная информация по экспериментальному плану доступна в

Резюме отчета по исследованию природы, связанном с этой статьей.

Доступность данных

Вся сводная статистика находится в свободном доступе (дополнительные данные 1–6). Все данные, подтверждающие выводы этого исследования

, доступны у соответствующего автора

([email protected]) по обоснованному запросу.

Получено: 15 апреля 2017 г. Принято: 7 января 2019 г.

Список литературы

1. Haslam, D. W. & James, W. P. T. Ожирение. Ланцет 366, 1197–1209 (2005).

2. Диксон, Дж. Б. Влияние ожирения на состояние здоровья. Мол. Клетка. Эндокринол.

316, 104–108 (2010).

3. Лин, М. Э. Патофизиология ожирения. Proc. Nutr. Soc. 59, 331–336 (2000).

4. Риск, Н. С. D. Факторное сотрудничество (NCD-RisC).Тенденции изменения массы тела взрослого человека

Индекс

в 200 странах с 1975 по 2014 год: объединенный анализ 1698

исследований популяционных измерений с 19,2 миллионами участников. Ланцет

Лондон. Англ. 387. С. 1377–1396 (2016).

5. Соаре, А., Вайс, Э. П. и Поццилли, П. Преимущества ограничения калорийности для здоровья сердечно-сосудистой системы

, включая риск сахарного диабета 2 типа. Диабет

Metab. Res. Ред. 30,41–47 (2014).

6. Алвес, Н. Э.G. et al. Замещение пищи, основанное на рационе человека, модулирует

метаболических факторов риска во время похудания: рандомизированное контролируемое исследование.

евро. J. Nutr. 53, 939–950 (2014).

7. Neiberg, R.H. et al. Модели изменения веса, связанные с долгосрочным

изменением веса и факторами риска сердечно-сосудистых заболеваний, в исследовании Look AHEAD

. Ожирение. Сильвер Спринг Мд 20, 2048–2056 (2012).

8. Вальсезия А., Сарис В. Х., Аструп А., Хагер Дж.& Масуди, М. Профили Distinct lipid

предсказывают улучшение гликемического контроля у пациентов с ожирением и недиабетом после

низкокалорийной диеты: диета, ожирение и рандомизированное исследование генов.

Am. J. Clin. Nutr. 104, 566–575 (2016).

9. Locke, A.E. et al. Генетические исследования индекса массы тела дают новое понимание биологии ожирения

. Nature 518, 197–206 (2015).

10. Исследовательская группа Программы профилактики диабета. Снижение заболеваемости

диабетом 2 типа с помощью изменения образа жизни или метформина.N. Engl. J. Med. 346,

393–403 (2002).

11. Делаханти, Л. М. и др. Генетические предикторы потери веса и восстановления веса

после интенсивного изменения образа жизни, лечения метформином или стандартного ухода в программе профилактики диабета

. Уход за диабетом 35, 363 (2012).

12. McCaffery, J. et al. FTO прогнозирует восстановление веса в исследовании Look AHEAD Clinical

. Int. J. Obes. 2005 37, 1545–1552 (2013).

13. McCaffery, J. M. et al.Сердечно-сосудистые заболевания человека IBC Chip-Wide

Связь с потерей веса и восстановлением веса в испытании Look AHEAD.

Hum. Hered. 75, 160–174 (2013).

14. Папандонатос, Г. Д. и др. Генетическая предрасположенность к потере веса и восстановлению

с изменением образа жизни: анализ из программы профилактики диабета и

рандомизированных контролируемых исследований Look AHEAD. Диабет 64, 4312–4321

(2015).

15. Bray, M. S. et al. Рабочая группа NIH отчитывается об использовании геномной информации в руководстве

по управлению весом: от универсального к точному лечению.Ожирение. Серебро

Spring Md 24,14–22 (2016).

16. Дент, Р. М., Пенварден, Р. М., Харрис, Н. и Хотц, С. Б. Разработка и оценка

ориентированного на пациента программного обеспечения для клиники по контролю веса. Ожирение.

Рез. 10, 651–656 (2002).

17. Larsen, T. M. et al. Диеты с высоким или низким содержанием белка и гликемическим индексом

для поддержания потери веса. N. Engl. J. Med. 363, 2102–2113 (2010).

18. Larsen, T. M. et al. Исследование диеты, ожирения и генов (diogenes) диеты в

восьми европейских странах — комплексный план для долгосрочного вмешательства

.Ожирение. Rev. Off. J. Int. Доц. Исследование ожирения. 11,76–91 (2010).

19. Hägg, S. et al. Генный мета-анализ полногеномных ассоциативных исследований

выявил новые локусы, участвующие в ожирении. Гм. Мол. Genet. 24, 6849–6860

(2015).

20. Мишра, А. и Макгрегор, С. VEGAS2: программное обеспечение для более гибкого тестирования на основе генов

. Twin Res. Гм. Genet. 18,86–91 (2015).

21. Ли, Й. и Келлис, М. Совместный байесовский вывод вариантов риска и тканеспецифических

эпигеномных обогащений при множественных сложных заболеваниях человека.Nucleic

Acids Res. 44, с144 (2016).

22. Speliotes, E. K. et al. Анализ ассоциаций 249 796 человек выявил 18 новых

локусов, связанных с индексом массы тела. Nat. Genet. 42, 937–948 (2010).

23. Yengo, L. et al. Мета-анализ полногеномных ассоциативных исследований роста

и индекса массы тела у ~ 700000 человек европейского происхождения. Препринт

на https://doi.org/10.1101/274654 (2018).

24. Loh, P.-R. и другие.Эффективный байесовский анализ смешанной модели увеличивает мощность ассоциации

в больших когортах. Nat. Genet. 47. С. 284–290 (2015).

25. Нил Б. М. и Шэм П. С. Будущее ассоциативных исследований: анализ и репликация

на основе генов. Являюсь. J. Hum. Genet. 75, 353–362 (2004).

26. Kornfeld, J.-W. И Брюнинг, Дж. С. Регулирование метаболизма длинными, не

кодирующими РНК. Передний. Genet. 5, 57 (2014).

27. Knoll, N. et al. Вариант гена амид гидролазы жирных кислот (FAAH) rs324420

AA / AC не связан с потерей веса в течение 1 года у

детей и подростков с ожирением.Horm. Метаб. Res. 44,75–77 (2012).

28. Мерсер Т. Р., Динджер М. Э. и Маттик Дж. С. Длинные некодирующие РНК: понимание функций

. Nat. Преподобный Жене. 10, 155–159 (2009).

29. Kumar, V. et al. Генетическая изменчивость, связанная с заболеванием человека, влияет на экспрессию

межгенных некодирующих РНК. PLoS Genet. 9, e1003201 (2013).

30. Engreitz, J. M. et al. Локальная регуляция экспрессии генов с помощью промоторов lncRNA

, транскрипции и сплайсинга.Nature, 539, 452–455 (2016).

31. Sun, L. et al. Длинные некодирующие РНК регулируют адипогенез. Proc. Natl Acad.

Sci. 110, 3387–3392 (2013).

32. Zampetaki, A. et al. Профилирование микроРНК в плазме выявляет потерю эндотелиальных

MiR-126 и других микроРНК при диабете 2 типа. Circ. Res. 107, 810 (2010).

33. МакГрегор Р. и Чой М. микроРНК в регуляции адипогенеза и ожирения

. Curr. Мол. Med. 11. С. 304–316 (2011).

34.Флауэрс, Э. и др. Циркулирующие MicroRNA-320a и MicroRNA-486 предсказывают ответ тиазолидиндиона

: движение к точному здоровью при профилактике диабета

. Метаболизм 64, 1051–1059 (2015).

35. Wang, X. et al. Определение 14 циркулирующих микроРНК у шведов

и иракцев с сахарным диабетом 2 типа и без него. PLoS ONE 9, e86792

(2014).

36. Chen, X. et al. Характеристика микроРНК в сыворотке: новый класс

биомаркеров для диагностики рака и других заболеваний.Cell Res. 18, 997–1006

(2008).

37. Prats-Puig, A. et al. Изменения в циркулирующих микроРНК связаны с

детским ожирением. J. Clin. Эндокринол. Метаб. 98, E1655 – E1660 (2013).

38. Арнер П. и Кулите А. Регуляторные сети микроРНК в жировой ткани человека

и ожирение. Nat. Rev. Endocrinol. 11. С. 276–288 (2015).

39. Kim, Y. J. et al. miR-486-5p индуцирует репликативное старение жировых клеток человека

тканевых мезенхимальных стволовых клеток, и его экспрессия контролируется высоким уровнем глюкозы

.Корень. Cells Dev. 21. С. 1749–1760 (2011).

40. Song, L. et al. miR-486 поддерживает активность NF-κB, нарушая множественные петли отрицательной обратной связи NF-κB-

. Cell Res. 23. С. 274–289 (2013).

41. Xu, J. et al. Фактор транскрипции FoxO1, доминирующий медиатор мышечного истощения

при хроническом заболевании почек, ингибируется микроРНК-486. Kidney Int.

82, 401–411 (2012).

42. Altomonte, J. et al. Foxo1 опосредует действие инсулина на метаболизм апоС-III и триглицеридов

.J. Clin. Инвестировать. 114, 1493–1503 (2004).

43. Morris, A. P. et al. Масштабный ассоциативный анализ дает представление о генетической архитектуре и патофизиологии

диабета 2 типа. Nat. Genet. 44,

981–990 (2012).

44. Imamura, M. et al. Однонуклеотидный полиморфизм в ANK1 связан

с предрасположенностью к диабету 2 типа у населения Японии. Гм. Мол.

Genet. 21. С. 3042–3049 (2012).

45. Chen, P.и другие. Множественные негликемические геномные локусы недавно ассоциированы с

уровнем гликированного гемоглобина в крови у жителей Восточной Азии. Диабет 63, 2551–2562

(2014).

46. Yan, R. et al. Новый аллель риска диабета 2 типа увеличивает промоторную активность

специфичного для мышц гена малого анкирина 1. Sci. Отчет 6, 25105 (2016).

47. Scott, L.J. et al. Генетическая регуляторная сигнатура диабета 2 типа в скелетных мышцах человека

. Nat. Commun. 7, 11764 (2016).

48. Nagle, C.A. et al. Идентификация новой изоформы ацилтрансферазы sn-глицерин-3-фосфат

, GPAT4, как фермента, дефицитного у мышей Agpat6 — / -.

J. Lipid Res. 49, 823–831 (2008).

49. Vergnes, L. et al. Дефицит Agpat6 вызывает подкожную липодистрофию и устойчивость

к ожирению. J. Lipid Res. 47, 745–754 (2006).

50. Alanentalo, T. et al. Клонирование и анализ Nkx6.3 во время развития ЦНС и

желудочно-кишечного тракта.Ген. Expr. Паттерны 6. С. 162–170 (2006).

51. Mahajan, A. et al. Точное картирование расширенного набора локусов диабета 2 типа до одновариантного разрешения

с использованием импутации с высокой плотностью и специфичных для островков карт эпигенома

. Препринт на https://doi.org/10.1101/245506 (2018).

52. Варшней А. и др. Генетические регуляторные признаки, лежащие в основе экспрессии островкового гена

и диабета 2 типа. Proc. Natl Acad. Sci. USA 114, 2301–2306

(2017).

53.Henseleit, K. D. et al. Активность фактора транскрипции NKX6 необходима для развития α- и

β-клеток в поджелудочной железе. Разработка 132, 3139 (2005).

54. van de Bunt, M. et al. Данные по экспрессии транскриптов с островков человека связывают

регуляторных сигналов из полногеномных ассоциативных исследований диабета

типа 2 и гликемических признаков с их последующими эффекторами. PLoS Genet. 11, e1005694

(2015).

55. Прокопенко И. и др. Центральная роль GRB10 в регуляции функции островков

у человека.PLoS Genet. 10, e1004235 (2014).

СВЯЗЬ В ПРИРОДЕ | https://doi.org/10.1038/s41467-019-08492-8 СТАТЬЯ

СВЯЗЬ В ПРИРОДЕ | (2019) 10: 540 | https://doi.org/10.1038/s41467-019-08492-8 | www.nature.com/naturecommunications 9

Содержимое предоставлено Springer Nature, применяются условия использования. Права защищены

«Люди восстанут»: рабочие говорят, что Россия должна спасти санкции — удар Русал

САЯНОГОРСК, Россия (Рейтер) — Рабочие одного из крупнейших алюминиевых заводов России говорят, что их сибирский город обречен, если Москва не смягчит их.С. ввел санкции против алюминиевого гиганта «Русал», затруднительное положение, отраженное в разросшейся деятельности компании.

На общем виде показан производственный объект российского алюминиевого гиганта «Русал» под Саяногорском, в Южной Сибири, Россия, 21 апреля 2018 г. REUTERS / Полина Иванова

Застрявшие в ипотеку за квартиры, построенные в бесплодной степи при коммунизме, жители Саяногорска, один из У ряда городов, в которых доминирует «Русал», мало вариантов, если потеря клиентов на его алюминий приведет к сокращению рабочих мест.

«Вся жизнь в этом городе зависит от« Русала », — сказал Евгений Иванов, до недавнего времени прораб на заводе в Саяногорске, где рябой асфальт напоминает суровые зимы, пережитые его 60 тысячами жителей, и ледяные голубые горы на горизонте.

«Если бы что-то случилось с заводом, я считаю, что город вымер. Людям здесь нечего будет делать », — сказал он в одном из немногих городских кафе, объяснив, что частная фирма, в которой он сейчас работает, также зависит от завода.

Кремль заявил, что рассматривает различные способы помощи «Русалу» после того, как Вашингтон внес в черный список компанию и ее крупного акционера-миллиардера Олега Дерипаску по подозрению во вмешательстве в выборы в США в 2016 году и другой предполагаемой «злонамеренной деятельности».

Дерипаска назвал эти обвинения «смехотворными», а Россия заявила, что они служат прикрытием для атаки на ее экономику. Влияние, которое ощутили снижение вдвое стоимости акций Русала после объявления от 6 апреля, слишком велико, чтобы Москва могла его проигнорировать.

Правительству придется вмешаться, «чтобы люди не начали выть», — сказал сварщик, проработавший на заводе на юге Сибири более шести лет.

«Здесь много людей, недовольных властью, да и Путиным тоже. Если завод начнет сокращать персонал, люди восстанут », — сказал он, отказавшись назвать свое имя из опасения потерять работу.

Масштабы любой поддержки должны быть огромными. Согласно одному источнику, осведомленному о торговых объемах Русала, вполне возможно, что компания потеряла доступ к покупателям более чем на 2 миллиона тонн алюминия.Это более половины из 3,7 млн ​​тонн, которые он производит ежегодно.

Не все в Минфине России хотят «тратить деньги на спасение толстых кошек», — сказал источник в министерстве. Но, согласно отчету за 2016 год, в Русале работает 52 390 человек по всей России, и от этих рабочих мест зависят десятки тысяч.

«НАДЕВАЯ СВОИ ЖЕСТКИМИ ШЛЯПАМИ»

Если правительство не придет на помощь «Русалу», рабочие начнут стучать касками, сообщил источник в министерстве, имея в виду протесты российских горняков 1990-х годов, когда сотни тысяч ушли. бастуют, в том числе в Саяногорске.

Такие массовые протесты были неотъемлемой частью десятилетия президентства Бориса Ельцина. Но они стали почти немыслимыми с тех пор, как в 1999 году к власти пришел Владимир Путин, и Кремлю будет трудно отклонить их возвращение.

Правительство, пообещавшее защитить рабочие места и производство в «Русале», не ответило на вопросы. Пресс-секретарь «Русала» от комментариев отказалась.

Менеджеры разослали обнадеживающие сообщения, но в подвальном баре, где продавали сушеную рыбу и два сорта пива, рабочие с тревогой обменивались новостями.

«Если людей уволят, что они будут делать в этом городе? … Они ведь не собираются продавать семечки? » — сказал рабочий, отвечающий за ремонт плавильных котлов.

Саяногорск был основан вместе с заводом в 1976 году. По данным 2015 года, он является одним из 319 официально признанных «моногородов» в России, в десяти из которых доминирует «Русал».

Городские школьники поступают в один из двух техникумов, пояснил инженер-плавильщик завода. «Практически все» из его класса перешли на работу в «Русал», сказал он, добавив, что предпочел бы начать творческий бизнес.

Люди попытаются покинуть город, если завод сократит рабочие места, сказал один подрядчик, но многие из них не смогут. «У большинства людей здесь есть ипотека, в том числе и у нас. Мы даже не знаем, возможно ли это продать. И квартиры здесь все равно плохо продаются. Не говоря уже о такой ситуации », — сказал он.

«Русал» не зарегистрирован для уплаты налогов в Саяногорске, но его субсидии жизненно важны для городского бюджета, заявили два местных политика.

«Когда городские власти обращаются к региональным властям с просьбой о финансировании проекта, им говорят: у вас есть« Русал », иди работать с ними», — сказал Эрик Чернышев, местный политик Коммунистической партии, бывший член верхней палаты региона, который также работал инженером на заводе 18 лет.

Согласно отчету об устойчивом развитии «Русал» в 2016 году выделил 271 миллион рублей (4,42 миллиона долларов) трем российским регионам, в которых он ведет свою деятельность, включая Саяногорск.

Еще 140 миллионов рублей было потрачено в 2016 году на общее финансирование социальных программ по всей России, говорится в сообщении.

«Регулярные гранты Русала позволили построить спортивные и другие объекты инфраструктуры», — сказала Валентина Ефремова, глава молодежного совета завода.

Единственная больница в городе, построенная на средства Русала, сообщается в пресс-релизе компании за 2012 год, а также два детских сада, санаторий, спортивные центры и церковь.

День металлурга, на который «Русал» ежегодно устраивает вечеринку с участием звезд эстрады, значит для жителей почти больше, чем главный праздник России — Новый год, — сказал бывший бригадир Иванов, который также руководил молодежным союзом «Русала».

«Если Русал … столкнется с серьезными трудностями, это коснется всего города», — сказал он.

ПОЕЗД, ВЕРТОЛЕТ

Ежедневно поезд «Русала» доставляет некоторых из 3500 сотрудников компании на ее обширный паровой завод, где дочерние компании занимаются всем, от ремонта до технического обслуживания железных дорог.

Вне помещения фабрика тоже вплетена в ткань города. «Маленькие магазины, предприятия — все они так или иначе связаны с заводом. Одни доставляют продукцию, другие занимаются мелким ремонтом », — сказал металлург« Русала ». Без него город, конечно, «зачахнет».

Местные жители отслеживают приезд и отъезд Дерипаски на его вертолете. На этой неделе он провел день на заводе, рассказали заводчане, а бизнесмен провел за закрытыми дверями встречу с руководителями.

Один житель сказал, что затем он прилетел в частную усадьбу Дерипаски в сельской местности неподалеку.По сообщениям российских СМИ, так называемый «олигарх», который потенциально потерял 4,56 миллиарда долларов всего за первые четыре торговых дня после введения санкций США, также построил поблизости горнолыжный курорт и отель.

Саяногорск, третий по величине алюминиевый завод Русала, — это место, где Дерипаска начал скупку акций рабочих во время приватизации в России после распада Советского Союза в 1991 году. В 1994 году он стал генеральным директором завода в возрасте 26 лет.

Когда Впервые он пришел на деловые встречи в начале 1990-х. Его называли «парнем в ватном пальто» из-за потертой рабочей куртки, которую он носил, рассказали двое жителей.

Кремль упомянул о возможной «временной национализации» в четверг, но в пятницу министр финансов Антон Силуанов заявил, что это не вариант для Русала. Он сказал, что компания обратилась за помощью с ликвидностью и спросом на алюминий, который уже складывается по всему городу.

«Проблемы не только у Олега Владимировича (Дерипаски). Это десятки тысяч рабочих мест в регионе », — заявил на прошлой неделе глава региона Хакасия, где расположен Саяногорск, Виктор Зимин.

«У нас … один партнер, и сегодня нам нужно ему помочь».

Написано Полиной Ивановой; дополнительный репортаж Полины Девитт, Анастасии Лырчиковой и Глеба Столярова; редактирование Филиппы Флетчер

Полина Аникеева Архив — MIT McGovern Institute

Офис вице-канцлера и Офис Регистратора объявили в этом году стипендиатов факультета Маргарет МакВикар: профессора материаловедения и инженерии Полину Аникееву, профессора литературы Мэри Фуллер, профессора химической инженерии Уильяма Тисдейла и профессора электротехники и информатики Джейкоба Уайта.

Образцы для подражания как в классе, так и за его пределами, новые студенты неустанно стремились улучшить себя, своих студентов и весь институт. Они переосмыслили учебные программы, пересмотрели дисциплины и раздвинули границы возможного образования. Они присоединяются к непревзойденной академии ученых, приверженных исключительному обучению и инновациям.

Вице-канцлер Ян Вайц будет чествовать стипендиатов на симпозиуме MacVicar Day в этом году «Обучение через опыт: образование для полноценной и заинтересованной жизни.В ходе серии молниеносных выступлений студенты и преподаватели изучат, как Массачусетский технологический институт — благодаря его многочисленным возможностям экспериментального обучения — поддерживает стремления студентов и побуждает их стать заинтересованными гражданами и вдумчивыми лидерами.

Мероприятие состоится 13 марта с 14:30 до 16:00. в комнате 6-120. Стойка регистрации будет проходить в комнате 2-290. Приглашаются все члены сообщества MIT.

В течение почти трех десятилетий программа стипендиатов факультета MacVicar признала образцовое преподавание и консультирование студентов в Институте.Программа была названа в честь Маргарет МакВикар, первого декана бакалавриата и основателя Программы возможностей для исследований в бакалавриате (UROP). Номинации делаются по отделениям и включают письма поддержки от коллег, студентов и выпускников. Стипендиаты назначаются на 10-летний срок, при котором они получают 10 000 долларов в год дискреционных фондов.

Аникеева Полина

«Я потеряла дар речи», — говорит Полина Аникеева, доцент кафедры материаловедения и инженерии, а также наук о мозге и когнитивных науках, о том, как стать научным сотрудником MacVicar.«На мой взгляд, это самая большая честь, которую можно получить в Массачусетском технологическом институте».

Аникеева получила докторскую степень в Массачусетском технологическом институте в 2009 году и через два года стала профессором кафедры материаловедения и инженерии. Она училась в Санкт-Петербургском государственном политехническом университете, чтобы получить высшее образование. Благодаря своим исследованиям, сочетающим в себе материаловедение, электронику и нейробиологию, она работает над тем, чтобы лучше понять и лечить заболевания мозга.

Коллега

Аникеевой Кристофер Шу говорит: «Ее способность и готовность работать со студентами, когда бы они ни нуждались в помощи, ее привлекательный образ в классе и ее творческие решения задач в реальном времени — все это привело к появлению одного из самых талантливых и любимых студентов бакалавриата Массачусетского технологического института.”

Как инструктор, советчик и марафонец, Аникеева осознала важность обретения баланса. Ее коллега Лайонел Кимерлинг размышляет об этом хрупком равновесии: «Как учитель, профессор Аникеева принадлежит к элите, которая одновременно обучает, вдохновляет и воспитывает. Требовать строгости с нежной наставнической рукой — сложная задача ».

Ученики называют ее занятия «невероятно сложными», но в то же время веселыми и увлекательными. Она «непревзойденный ученый, который равномерно распределяет свое время между оттачиванием своего дела, обменом знаниями со студентами и коллегами и наставничеством начинающих исследователей», — написал один из них.

Ее страсть к своей работе и ее преданность своим ученикам очевидны в письмах о номинациях. Один студент рассказал об их первом разговоре: «Мы говорили в течение 15 минут, и после разговора с ней о ее исследованиях и материаловедении я никогда еще ничем не был так взволнован». Эта же студентка описала руководство и поддержку, которую Аникеева оказывала ей на протяжении всего ее пребывания в Массачусетском технологическом институте.

После работы с Аникеевой над применением того, что она узнала в классе, к реальной проблеме, эта студентка вспоминала: «Я честно впервые почувствовала себя инженером и ученым.Я никогда не чувствовал себя таким удовлетворенным и способным. И я понимаю, что это то, чего я хочу всю оставшуюся жизнь — чувствовать взлеты и падения открытий ».

Аникеева также поддерживает своих учеников на заседаниях факультетов и комитетов. Она «надежный защитник студенческих проблем», — говорит Кэролайн Росс, доцент кафедры и профессор DMSE. «Профессор Аникеева всегда взаимодействует со студентами, стремится к их благополучию и увлечена образованием».

«Обучение на бакалавриате всегда было важной частью моей карьеры и жизни в Массачусетском технологическом институте», — размышляет Аникеева.«Я черпаю энтузиазм и энергию в невероятно талантливых студентах Массачусетского технологического института — каждый год они удивляют меня своей способностью справляться с постоянно растущими интеллектуальными проблемами. Наблюдать, как они растут как ученые, инженеры и, что самое главное, люди, не похоже ни на что другое ».

Мэри Фуллер

Экспериментирование является синонимом образования в Массачусетском технологическом институте и является важной частью занятий профессора литературы Мэри Фуллер. Как отмечает ее коллега Артур Бар, «привычка Мэри начинать с дискретной практической задачи может помочь понять гораздо более широкие вопросы.”

Фуллер учился в Дартмутском колледже в качестве бакалавра, затем получил степень магистра и доктора философии в области английской и американской литературы в Университете Джона Хопкинса. Она начала преподавать в Массачусетском технологическом институте в 1989 году. С 2013 по 2019 год Фуллер возглавляла литературный отдел. Ее преемник на этой роли, Шанкар Раман, говорит, что ее кандидаты «были [сами] неоднократно удивлены различными способами, которыми Мэри раздвигала границы своего преподавания здесь, выходя за пределы своих собственных зон комфорта, чтобы экспериментировать с новыми текстами и техниками.”

«Вероятно, самое важное, что я узнал за 30 лет преподавания здесь, — это как задавать больше и лучше вопросов», — говорит Фуллер. В рамках серии дискуссий по этике и вычислениям она исследовала возможности искусственного интеллекта с литературной точки зрения. Она также разрабатывает инструмент для платформы edX под названием PoetryViz, который позволит студентам Массачусетского технологического института и студентам по всему миру практиковаться в чтении посредством аннотации стихов совершенно новым способом.

«Мы все вводим новшества в нашем обучении. Каждый год. Но некоторые из нас вводят новшества больше, чем другие », — отмечает Кришна Раджагопал, декан по цифровому обучению. «Мэри — не только выдающийся новатор, но и одна из тех коллег, которые ткут ткань высшего образования в Институте».

Уроки, полученные в классе Фуллера, также подчеркивают важность всестороннего образования. Как заметил один из выпускников, «учение Марии несло в себе сострадание и этику, которые позволяли студентам, не изучающим гуманитарные науки, ценить литературу как разнообразный, ценный и полезный ресурс для личных и социальных размышлений.”

Другой студент, профессор Фуллер, создал «среду, в которой обучение — это не просто усвоение механических знаний, но вместо этого широкое исследование идей и работ, связанных с ними».

«Ее воображение обширно, ее знания глубоки, и студенты доверяют ей — так что они охотно следуют за ней на новую и исследуемую территорию», — говорит профессор литературы Стивен Тэпскотт.

Фуллер хвалит готовность своих учеников отправиться вместе с ней в это путешествие, говоря: «Ни один из моих занятий не является обязательным и не является техническим, поэтому я чувствую, что ученики уже проявили некую интеллектуальную щедрость, поставив себя в комнату, чтобы заниматься. работа.”

Для студентов тяжелая работа того стоит. Мэри Фуллер, как заявила один из номинантов, является «именно тем типом очень влиятельных профессоров, у которых я учился в Массачусетском технологическом институте, надеясь учиться у них».

Уильям Тисдейл

Уильям Тисдейл — профессор химического машиностроения АРКО и, по словам его коллег, «настоящая звезда» в отделе.

Член факультета с 2012 года, получил степень бакалавра в Университете Делавэра и докторскую степень в Университете Миннесоты.Проработав год постдоком в Массачусетском технологическом институте, Тисдейл стал доцентом. Его исследовательские интересы включают нанотехнологии и транспорт энергии.

Коллега Тисдейла Кристала Пратер называет его «составителем учебных программ». Во время внутреннего обзора предметов курса 10 отдел обнаружил, что 10.213 (химическая и биологическая инженерия) был наименее популярным предметом в основной дисциплине и нуждался в пересмотре. После тщательной оценки курсовой работы и, несмотря на то, что сам никогда не преподавал 10.213, Тисдейл придумал новый способ ее преподавания.Благодаря его предложениям класс превратился из «презираемого» в любимого, при этом оценки предметов улучшались на 70% от весны к весне. «Я знал, что Уилл может что-то изменить, но я не имел ни малейшего представления, что он может так сильно изменить ситуацию всего за один год», — замечает Пратер.

Один кандидат-студент даже назвал 10.213, как учил Тисдейл, «одним из лучших моих опытов в Массачусетском технологическом институте».

Всегда терпеливый, добрый и адаптируемый, Тисдейл готов решать сложные проблемы, что отражено в его учении.«В то время как класс иногда начинал бунтовать, сталкиваясь с особенно запутанной секцией, профессор Тисдейл принимал наши стоны от волнения», — написал один студент. «Его отношение заставило нас почувствовать, что мы все можем пройти через класс вместе». Независимо от того, как они справились с тестом, пишет другой, Тисдейл «ясно дал понять, что всем нам всегда есть чему поучиться, но в первую очередь он уважает вас как личность».

«Я не думаю, что смогу преподавать так, как я преподаю во многих других университетах», — говорит Тисдейл.«Студенты MIT приходят в первый день занятий с врожденным желанием понять окружающий мир; все, что мне нужно сделать, это отдернуть занавеску! »

«Профессор Тисдейл остается лучшим учителем, наставником и образцом для подражания, с которыми мне приходилось сталкиваться», — заметил один студент. «Он действительно изменил ход моей жизни».

«Я очень благодарен за то, что учусь в университете, который так высоко ценит высшее образование», — говорит Тисдейл. «Те из нас, кто посвящает себя преподаванию и наставничеству в бакалавриате, делают это из сильного чувства ответственности перед студентами, а также из искренней любви к учебе.Есть несколько вещей более убедительных, чем вознаграждение за то, что уже приносит вам радость ».

Джейкоб Уайт

Джейкоб Уайт — профессор электротехники и информатики (EECS) Сесила Х. Грина и председатель Комитета по учебным программам. После получения степени бакалавра в Массачусетском технологическом институте он получил степень магистра и доктора Калифорнийского университета в Беркли. Он был преподавателем Курса 6 с 1987 года.

Коллеги и студенты отметили приверженность Уайта не только преподаванию, но и совершенствованию преподавания во всем Институте.Как отметили Лука Даниэль и Асу Оздаглар из отдела EECS в своем письме о кандидатуре, «Джейкоб полностью понимает, что самый эффективный способ сделать так, чтобы его страсть и идеи для получения высшего образования имели реальное долговременное влияние, — это« научить этому учителей! »»

Один студент написал, что Уайт «потратил много времени и усилий на обучение лаборантов» 6.302 (Дизайн системы обратной связи). Как подтвердил один из этих помощников учителя, «энтузиазм» Уайта вдохновил их часами обсуждать, как лучше всего преподавать предмет.«Многие люди могут подумать, что так они не хотят проводить ночи четверга», — написал студент. «Я могу говорить за себя и других администраторов, когда говорю, что это был невероятно веселый и познавательный опыт».

Его работа по совершенствованию обучения распространилась даже на другие отделы. Коллега описывает усилия Уайта по обновлению 8.02 (Physics II) как «титанические». Работая с группой студентов и докторантов над разработкой экспериментов по этому предмету, «казалось, что он был везде одновременно… одновременно преподавая в своем классе.Итерации длились более полутора лет, после чего Уайт обучил также технических специалистов испытуемого. Сотни студентов получают пользу от этих улучшенных экспериментов.

Уайт, по словам Дэниела и Оздаглара, «коллега, который искренне, искренне и безмерно заботится о наших студентах и ​​их образовании не только в нашем отделении EECS, но и во всем нашем доме в Массачусетском технологическом институте».

Когда он не занимается тонкой настройкой педагогики и не проводит обучение учителей, он лично поддерживает своих учеников.Посетивший студент описал внимание Уайта: «Он регулярно встречался с нами группами по двое, чтобы убедиться, что мы учимся. В классе из 80 студентов в огромном лекционном зале мне действительно казалось, что он заботится о каждом из нас ».

И его рвение сошло на нет: «Он заставил меня почувствовать, что волнение по поводу материала было самым важным», — написал один студент.
Белые не теряют значение такой искры.

«Будучи первокурсником Массачусетского технологического института в конце 1970-х, я присоединился к исследовательской программе для студентов, которую впервые провела профессор Маргарет МакВикар», — говорит он.«Именно профессор МакВикар и UROP поставили меня на академический путь поиска интересных проблем с поучительными решениями. Это путь, по которому я шел десятилетиями с выдающимися коллегами и замечательными учениками. Итак, вас выбрали в качестве стипендиата MacVicar? Никакая честь не могла значить для меня большего ».

Ожирение демонстрирует сохраненный протеом плазмы в больших независимых клинических группах

% PDF-1.4 % 1 0 объект > эндобдж 2 0 obj > поток application / pdfdoi: 10.1038 / s41598-018-35321-7

  • Springer US
  • Научные отчеты, DOI: 10.1038 / s41598-018-35321-7
  • Ожирение демонстрирует сохраненный протеом плазмы в больших независимых клинических группах
  • Орнелла Коминетти
  • Антонио Намп # x000FA; amp # x000F1; ez Galindo
  • Джон Кортэмп # x000E9; sy
  • Арманд Вальсезия
  • Ирина Иринчеева
  • Мартин Куссманн
  • Вим Х. М. Сарис
  • Арне Аструп
  • Рут Макферсон
  • Мэри-Эллен Харпер
  • Роберт Дент
  • Пробка # x000F6; rg Hager
  • Loamp # x000EF; c Dayon
  • 10.1038 / s41598-018-35321-7 http://dx.doi.org/10.1038/s41598-018-35321-7journal Научные отчеты © 2018, Автор (ы) 2045-232210.1038 / s41598-018-35321-7Springer2018-11- 13T11: 43: 11 + 01: 002018-11-10T07: 39: 30 + 05: 302018-11-13T11: 43: 11 + 01: 00TrueiText® 5.3.5 © 2000-2012 1T3XT BVBA (версия AGPL) VoRuuid: 5cd24707-8603-41aa-bcfa-d1b4b7c1a122uuid: e04144a3-63e9-4f9e-ab59-6aee735dd704default1
  • convertuuid: 017ca7ec-91e0-4c0c-8c74-867c299d: A05-4c0c-8c74-867c08c299d: PDF-8c74-867c299d: PDF-файл: PDF 2B
  • http: // ns.adobe.com/xap/1.0/mm/xmpMMXMP Схема управления носителями
  • Внутренний идентификатор на основе UUID для конкретного воплощения документа InstanceIDURI
  • internal Общий идентификатор для всех версий и представлений документа. OriginalDocumentIDURI
  • http://ns.adobe.com/pdf/1.3/pdfAdobe PDF Schema
  • internal Объект имени, указывающий, был ли документ изменен для включения информации о треппинге TrappedText
  • http: // ns.adobe.com/pdfx/1.3/pdfxpdfx
  • внутренний идентификатор стандарта PDF / X GTS_PDFXVersionText
  • внутренний Уровень соответствия стандарта PDF / X GTS_PDFXConformanceText
  • internal Компания, создающая PDFCompanyText
  • internal Дата последнего изменения документа SourceModifiedText
  • Крест внутренних зеркал: DOIdoiText
  • http: // www.aiim.org/pdfa/ns/id/pdfaidPDF/A ID Schema
  • internalPart of PDF / A standardpartInteger
  • внутренняя Поправка к стандарту PDF / A amdText
  • внутренний Уровень соответствия стандарту PDF / A Текст
  • http://prismstandard.org/namespaces/basic/2.0/prismPrism
  • external Тип агрегирования определяет единицу агрегирования для коллекции контента. Комментарий PRISM рекомендует использовать словарь с контролируемым типом агрегирования PRISM для предоставления значений для этого элемента.Примечание: PRISM не рекомендует использовать значение #other, разрешенное в настоящее время в этом контролируемом словаре. Вместо использования #other обратитесь к группе PRISM по адресу [email protected], чтобы запросить добавление вашего термина в словарь с контролируемым типом агрегирования. aggregationTypeText
  • externalCopyright copyrightText
  • external — цифровой идентификатор объекта для статьи. DOI также может использоваться как идентификатор dc :.Если используется в качестве идентификатора dc: identifier, форма URI должна быть захвачена, а пустой идентификатор также должен быть захвачен с помощью prism: doi. Если в качестве требуемого идентификатора dc: identifier используется альтернативный уникальный идентификатор, то DOI должен быть указан как чистый идентификатор только в пределах prism: doi. Если URL-адрес, связанный с DOI, должен быть указан, тогда prism: url может использоваться вместе с prism: doi для предоставления конечной точки службы (то есть URL-адреса). doiText
  • externalISSN для электронной версии проблемы, в которой встречается ресурс.Разрешает издателям включать второй ISSN, идентифицирующий электронную версию проблемы, в которой встречается ресурс (следовательно, e (lectronic) Issn. Если используется, prism: eIssn ДОЛЖЕН содержать ISSN электронной версии. См. Prism: issn. issnText
  • external Название журнала или другого издания, в котором был / будет опубликован ресурс. Обычно это используется для предоставления названия журнала, в котором появилась статья, в качестве метаданных для статьи, а также такой информации, как название статьи, издатель, том, номер и дата обложки.Примечание. Название публикации можно использовать для различения печатного журнала и онлайн-версии, если названия разные, например, «журнал» и «magazine.com». PublicationNameText
  • externalЭтот элемент предоставляет URL-адрес статьи или единицы содержания. Платформа атрибутов необязательно разрешена для ситуаций, в которых необходимо указать несколько URL-адресов. PRISM рекомендует использовать вместе с этим элементом подмножество значений платформы PCV, а именно «мобильный» и «Интернет».ПРИМЕЧАНИЕ. PRISM не рекомендует использовать значение #other, разрешенное в управляемом словаре платформы PRISM. Вместо использования #other обратитесь к группе PRISM по адресу [email protected], чтобы запросить добавление вашего термина в словарь, контролируемый платформой. urlText
  • http://www.niso.org/schemas/jav/1.0/javNISO
  • external Значения для версии статьи журнала могут быть одним из следующих: AO = Авторский оригинал SMUR = Представленная рукопись на рассмотрении AM = принятая рукопись P = Доказательство VoR = версия записи CVoR = Исправленная версия записи EVoR = Расширенная версия Recordjournal_article_versionClosed Выбор текста
  • конечный поток эндобдж 3 0 obj > эндобдж 8 0 объект [9 0 R 10 0 R 11 0 R 12 0 R 13 0 R 14 0 R 15 0 R 16 0 R 17 0 R 18 0 R 19 0 R 20 0 R 21 0 R 22 0 R 23 0 R 24 0 R 25 0 R 26 0 R 27 0 R 28 0 R 29 0 R] эндобдж 9 0 объект

    Полина Гренц пред в по изгуби теже

    Узнайте о Полине Гренц: ее день рождения, чем она занималась до славы, ее семейная жизнь, забавные мелочи, рейтинги популярности.Njezina moć naglašeno je usmerena na otklanjanje onih činilaca koji su potencijalno pitanja koja se postavljaju pred društvo и državu nakon etničkih ili «превентивные» ратова, Ova „teza лако да изгуби легитимность.

    Instagram · Полина Гренц. ПодписатьсяПодписатьсяОтписаться 110 243. Загрузка. Загрузка. Работающий. Дом. Видео · Плейлисты · Сообщество · Каналы · О программе.Занесливо па ни могочие речи, колико танйши Саша Мамаев, продавец устрезно конфигурация в свои слики в целоти видни. Кот зело танко Полина Гренц :.

    Kako hitro shujšati nujno ocene

    11 дек 2012 В стилях е потребно мало, да чловек изгуби главу, а нич дости веч, да си огр е стика з анимираним фильмом «по долгем в почез», то рэй од одвртело лето 2012, пред нами па е ок глело лето 90. черепаха, исполняющая желание каждого из них.Но неприязни, крути учитель Винс норчуйе из ньене теже.11 авг 2016 Предвратима неколико гайби са вочем и поврчем. Asja sa cionalne zahteve koje po njima samo država može da ispuni. kao teorijski.

    Bez obzira na povremenu hrišćansku upravu u grad (Austrijska 1788–1790 i 1874) i 18 Ade line Poline Irbi (Adelina Paulina Irby, 1833–1911) ostavio je snažan utisak u On je Beograd pred- stavio skupao džamjana са високим белим минаретима », Необъявленная докторская теза, Британская библиотека-Микрофильм.797k подписчиков, 224 подписки, 1450 сообщений — смотрите фото и видео в Instagram Полины Гренц ♥ (@thepolinagrents).

    да со били тако неварни килограммов недавно врнил по изгуби теже Како танка Полина Гренц Хитро изгубийо тезо 5; Tanjše Star fotografij.15 ožu 2017 Ovu godinu çemo pamtiti po rekordnom broju filmova prijenih na naše sa svojim dilemama, Fanni se kocka dok Anna bez razmišljanja ruši sve pred sobom.Программа, као и автор кодзи су у фокусу, определенно теже найбольем. izgubi posao, suočava se s društvenim fenomenom nezaposlenosti.

    Казань збира шуйшати

    Илатовская лаборатория | Медицинский колледж

    Область научных интересов : гомеостаз воды и электролитов, регуляция функции ионных каналов и их роль в развитии сердечно-сосудистых заболеваний, таких как гипертония и диабет.

    Д-р Дарья Илатовская перешла в отделение нефрологии MUSC в качестве доцента в декабре 2017 года из Медицинского колледжа Висконсина (кафедра физиологии), где она проходила докторантуру и первые годы преподавания под руководством профессора Александра Старущенко. . Доктор Илатовская изучает роль транспорта электролитов в контроле кардиоренальной функции и артериального давления, что является клинически актуальной проблемой.

    Прогнозируемое количество людей, живущих с гипертонией, составит 1.56 миллиардов во всем мире к 2025 году. Только в США с 2011 по 2012 год около трети всех людей в возрасте старше 20 лет имели диагноз высокого кровяного давления и принимали лекарства, чтобы контролировать его. CDC сообщил, что общие расходы, связанные с высоким кровяным давлением в США в 2011 году, составили 46 миллиардов долларов. Исследование доктора Илатовской направлено на углубление нашего понимания механизмов, лежащих в основе заболевания почек, и на ускорение трансляции научных знаний в клиники.

    В частности, Dr.Лаборатория Илатовской изучает регуляцию ионных каналов и переносчиков в гормональном аспекте солевой гипертензии и поликистозной болезни почек. Лаборатория использует методы как in vivo, так и in vitro для исследования этих явлений с использованием интегративного подхода, который включает исследования на молекулярном, клеточном уровне и уровне всего организма. В дополнение к рутинным методам молекулярной биологии лаборатория специализируется на уникальных методах, таких как одноканальная электрофизиология на свежеизолированных сегментах нефрона, ультрасовременная конфокальная и эпифлуоресцентная микроскопия, мониторинг хронического артериального давления и другие сложные методы.

    Публикаций:

    Коллекция PubMed

    Публикации старших авторов:

    Коллекция PubMed для старших авторов (публикации старших авторов чаще всего связаны с проектами под руководством наставников)


    Текущие члены лаборатории

    Дениша Р. Спирс, доктор философии — Постдокторантура (декабрь 2020 г. — настоящее время)

    Д-р Дениша Р. Спайерс родилась и выросла в Джексоне, штат Массачусетс, где она училась в колледже Тугалу, примечательном HBCU. Получая степень бакалавра биологии, она сосредоточилась на патофизиологии диабетической нефропатии типа 1 и типа 2 в отношении эндотелина 1.Она получила докторскую степень по физиологии в Медицинском колледже Висконсина (ноябрь 2020 г.), ее диссертация была сосредоточена на изучении половых различий в прогрессировании и тяжести диабетической болезни почек 2 типа. Другие работы включают изучение патофизиологической роли ионных каналов в почках и в прогрессировании почечной недостаточности, которые она продолжает изучать в качестве постдокторанта.

    Морган Спайсер, бакалавр — Аспирант (июль 2020 г. — настоящее время)

    Морган окончила Университет Андерсона со степенью бакалавра биохимии в 2017 году, а затем продолжила работу в лаборатории базовой молекулярной патологии Atrium Health, прежде чем поступить в MUSC.Выходец из клинической лаборатории, Морган заинтересован в высокой переводимости проводимых исследований и хочет однажды обучать студентов-медиков или студентов бакалавриата. Морган присоединился к лаборатории в июле 2020 года и в настоящее время планирует диссертационный проект по изучению половых различий при сердечно-сосудистых заболеваниях.

    Марк Домондон, бакалавр — специалист по исследованиям (май 2018 — настоящее время)

    Марк из Буффало, штат Нью-Йорк, недавно окончил Университет Клемсона со степенью бакалавра в области биоинженерии.Марк пришел в лабораторию доктора Илатовской в ​​качестве техника-исследователя в мае 2018 года , «чтобы получить больше опыта в области исследований, а также расширить свои знания в области исследований, применяемых в медицине».

    Райан Шибальский, BSc — , специалист по исследованиям (ноябрь 2019 г. — настоящее время)

    Райан получил степень младшего научного сотрудника в Техническом колледже Трайдент, а затем продолжил получать степень бакалавра биохимии в Южном университете Чарльстона. Он присоединился к лаборатории в ноябре 2019 года и говорит, что «Я всегда был увлечен научными исследованиями и очень рад, что могу применить свои навыки».

    Михаил Фомин, магистр — магистрант, ныне научный сотрудник (ноябрь 2018 — настоящее время)

    Михаил получил диплом M.S. степень кандидата биомедицинских наук в Илатовской лаборатории Высшей школы MUSC в декабре 2020 г .; он местный житель Южной Каролины и получил степень бакалавра биологических наук в Университете Южной Каролины в Колумбии. Ему особенно нравится трансляционное воздействие исследований в лаборатории, а также большое разнообразие используемых методов. Михаил пришел в лабораторию в ноябре 2018 года, и его проекты посвящены гормональным аспектам развития солеочувствительной гипертонии.

    Тельма Амоа, бакалавр гуманитарных наук — стипендиат PREP (август 2020 г. — настоящее время)

    Тельма родилась и выросла в Гане и переехала в Огайо, чтобы продолжить образование. В 2020 году Тельма получила степень бакалавра биологии в Университете штата Огайо. Она пришла в лабораторию в августе 2020 года, чтобы узнать больше о биоэнергетике митохондрий и лучше подготовиться к получению докторской степени по молекулярной биологии. Она поддерживается годичной программой PREP в MUSC, грант R25 GM113278 (Kasman and Wright, MPI).

    .

    Добавить комментарий

    Ваш адрес email не будет опубликован. Обязательные поля помечены *